EMAGE mouse gene expression spatial database

EMAGE:11404

Apoc1 apolipoprotein C-I ( MGI:88053)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_006736. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_006736_01	euxassay_006736_02	euxassay_006736_03	euxassay_006736_04

euxassay_006736_05	euxassay_006736_06	euxassay_006736_07	euxassay_006736_08	euxassay_006736_09

euxassay_006736_10	euxassay_006736_11	euxassay_006736_12	euxassay_006736_13	euxassay_006736_14

euxassay_006736_15	euxassay_006736_16	euxassay_006736_17	euxassay_006736_18	euxassay_006736_19

euxassay_006736_20	euxassay_006736_21	euxassay_006736_22	euxassay_006736_23

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T8191
Entity Detected:	Apoc1, apolipoprotein C-I ( MGI:88053)
Sequence:	sense strand is shown >T8191 GGCACGAGGCTTAGATCCAGGGTGCCCCTCCAACCAGGATGAGGCTCTTCATCGCTCTTCCTGTCCTGAT TGTGGTCGTAGCCATGACCTTGGAAGGCCCAGCCCCCGCCCAGGCGGCCCCGGATTTGTCCGGAACATTG GAGAGCATACCGGATAAACTGAAGGAGTTTGGGAACACTTTGGAAGACAAGGCCCGGGCAGCCATTGAAC ATATCAAACAGAAGGAAATTTTGACCAAGACCCGGGCCTGGTTCTCAGAGGCATTTGGCAAAGTGAAGGA GAAGTTGAAGACCACGTTCTCCTGAGCACCTGGCGGGCCACCTCGAAGCATCAAGGACATCCACGTAATG TGCCAGGTCCCTCTTCATCACAGACCAATAAAAAACGTGTAGAAGGCAAAAAAAAAAAAAAAAAAAAAAA AAAAA
Notes:	The probe template was PCR amplified from IMAGE:875610 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:875610 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:11405 same embryo
	EMAGE:11402 same embryo
	EMAGE:11401 same embryo
	EMAGE:11403 same embryo
	EMAGE:11406 same embryo
	EurExpress:euxassay_006736 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source