EMAGE mouse gene expression spatial database

EMAGE:11428

Gast gastrin ( MGI:104768)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_006638. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_006638_01	euxassay_006638_02	euxassay_006638_03	euxassay_006638_04

euxassay_006638_05	euxassay_006638_06	euxassay_006638_07	euxassay_006638_08	euxassay_006638_09

euxassay_006638_10	euxassay_006638_11	euxassay_006638_12	euxassay_006638_13	euxassay_006638_14

euxassay_006638_15	euxassay_006638_16	euxassay_006638_17	euxassay_006638_18	euxassay_006638_19

euxassay_006638_20	euxassay_006638_21	euxassay_006638_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

pancreas

strong

single cell

strong expression: see section 08 09 10 11 12 13 16 17

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T8159
Entity Detected:	Gast, gastrin ( MGI:104768)
Sequence:	sense strand is shown >T8159 CGGACGCGTGGGAGCGCCACAACAGCCAACTATTCCCCAGCTCTGTGGACAAGATGCCTCGACTGTGTGT GTACATGCTGGTCTTAGTGCTGGCTCTAGCTACCTTCTCGGAAGCTTCTTGGAAGCCCCGCTCCCAGCTA CAGGATGCATCATCTGGACCAGGGACCAATGAGGACCTGGAACAGCGCCAGTTCAACAAGCTGGGCTCAG CCTCTCACCATCGAAGGCAGCTGGGGCTCCAGGGTCCTCAACACTTCATAGCAGACCTGTCCAAGAAGCA GAGGCCACGAATGGAGGAAGAAGAAGAGGCCTACGGATGGATGGACTTTGGCCGCCGCAGTGCTGAGGAA GACCAGTAGGACTAGCAACACTCTTCCAGAGCCCAGCCATCTCCAGCCACCCCTCCCCCAGCTCCGTCCT TACAAAACATATTAAAAATAAGCTAGCTTCCAATGTAAAAAAAAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:6431366 using vector (pSPORT1) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:6431366 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	MGI:4825001 same experiment
	EurExpress:euxassay_006638 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source