Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11464

1500032L24Rik RIKEN cDNA 1500032L24 gene ( MGI:1916279)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11464 EMAGE:11464 EMAGE:11464 EMAGE:11464 EMAGE:11464
"Pseudo-wholemount" of euxassay_006832. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006832_01 euxassay_006832_02 euxassay_006832_03 euxassay_006832_04
EMAGE:11464 EMAGE:11464 EMAGE:11464 EMAGE:11464 EMAGE:11464
euxassay_006832_05 euxassay_006832_06 euxassay_006832_07 euxassay_006832_08 euxassay_006832_09
EMAGE:11464 EMAGE:11464 EMAGE:11464 EMAGE:11464 EMAGE:11464
euxassay_006832_10 euxassay_006832_11 euxassay_006832_12 euxassay_006832_13 euxassay_006832_14
EMAGE:11464 EMAGE:11464 EMAGE:11464 EMAGE:11464 EMAGE:11464
euxassay_006832_15 euxassay_006832_16 euxassay_006832_17 euxassay_006832_18 euxassay_006832_19
EMAGE:11464 EMAGE:11464 EMAGE:11464 EMAGE:11464
euxassay_006832_20 euxassay_006832_21 euxassay_006832_22 euxassay_006832_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11464Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11464_wholemount_strong.wlz
11464_wholemount_moderate.wlz
11464_wholemount_weak.wlz
11464_wholemount_possible.wlz
11464_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11464_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
vibrissa
moderate moderate
regionalmoderate expression: see section 07 08 09 21 22 weak expression: see section 23
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 16 17
pons mantle layer
moderate moderate
regionalmoderate expression: see section 08 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19 20
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 18
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 08 18 19 20
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10 18
ventral grey horn
weak weak
regionalweak expression: see section 10 11 12 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 16 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 15 16 17 18 weak expression: see section 08 09
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 04
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 04 05 06 22 23 weak expression: see section 07
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T8224
Entity Detected:1500032L24Rik, RIKEN cDNA 1500032L24 gene ( MGI:1916279)
Sequence:sense strand is shown

>T8224
GCGTGGGGTGTGGCTCCCGGCGAGGGGCGGAGCTGGAGATGGCGTCCACGGCGGCTCGGCGGCTGGCCTG
GGTTGCAGTTCGACCCGGGGCTCTCTGGAGCGGGCCGAGGGGGAGGAGAGGTGGCGATGTCTACACCGTA
CCGGGCAGCTCAGGTCTCAGCCAGGTACCGTCGAGGTCAGTCATCGTCACTCGCAGCGGCGCCATTTTGC
CCAAGCCGGTGAAAATGTCCTTTGGTCTTCTCCGAGTGTTCTCCATTGTGATCCCCTTTCTCTATGTCGG
GACACTCATCAGCAAGAACTTCGCTGCTCTGCTTGAGGAACATGACATTTTTGTCCCAGAGGATGACGAC
GACGACGATTAACAGGGCACAGGGAGCACAGGAGAAAGCACTGATGATGTGGTGGCATGCTCAGCTCCCT
CCCGTCGGCAGAAGGGTCAAGGAAAGCCCTCAGCCTCACCTCCTCATGGTTTGTGACAAGAGCCCAGAGT
CCTGTGCTTTGGGAGGCTCCCTCACGGCTGTCCACAGAGTACTGGAAATAACAAGCAAGCAAATTAGGAG
TGTATAATAAATGAGTCATGTATGAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1245697 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:1245697 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11467 same embryo
 EMAGE:11466 same embryo
 EMAGE:11465 same embryo
 EurExpress:euxassay_006832 same experiment
 MGI:4822610 same experiment
 EMAGE:31879 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS