Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11467

Hspb2 heat shock protein 2 ( MGI:1916503)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11467 EMAGE:11467 EMAGE:11467 EMAGE:11467 EMAGE:11467
"Pseudo-wholemount" of euxassay_006798. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006798_01 euxassay_006798_02 euxassay_006798_03 euxassay_006798_04
EMAGE:11467 EMAGE:11467 EMAGE:11467 EMAGE:11467 EMAGE:11467
euxassay_006798_05 euxassay_006798_06 euxassay_006798_07 euxassay_006798_08 euxassay_006798_09
EMAGE:11467 EMAGE:11467 EMAGE:11467 EMAGE:11467 EMAGE:11467
euxassay_006798_10 euxassay_006798_11 euxassay_006798_12 euxassay_006798_13 euxassay_006798_14
EMAGE:11467 EMAGE:11467 EMAGE:11467 EMAGE:11467 EMAGE:11467
euxassay_006798_15 euxassay_006798_16 euxassay_006798_17 euxassay_006798_18 euxassay_006798_19
EMAGE:11467 EMAGE:11467 EMAGE:11467 EMAGE:11467 EMAGE:11467
euxassay_006798_20 euxassay_006798_21 euxassay_006798_22 euxassay_006798_23 euxassay_006798_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11467Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11467_wholemount_strong.wlz
11467_wholemount_moderate.wlz
11467_wholemount_weak.wlz
11467_wholemount_possible.wlz
11467_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11467_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 24
upper leg muscle
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 19 20 21 22 23 24
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04
hand
strong strong
regionalstrong expression: see section 05 moderate expression: see section 01 02 03 04
tarsus rest of mesenchyme
strong strong
regionalstrong expression: see section 05 06 19 20 21
lower leg rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 03 04 05 23 24
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tongue muscle
strong strong
regionalstrong expression: see section 12 13 14 15 16 17 18 19
tongue extrinsic muscle
strong strong
regionalstrong expression: see section 11
tail paraxial mesenchyme
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T8193
Entity Detected:Hspb2, heat shock protein 2 ( MGI:1916503)
Sequence:sense strand is shown

>T8193
GGCTACTAGTCGCAACAGCAGTCATGTCGGGCCGCACAGTGCCACACGCCCACCCAGCCACTGCCGAGTA
CGAATTTGCCAACCCCAGCCGTCTGGGCGAGCAGTGCTTCGGAGAAGGCCTCCTGCCAGAAGAGATCCTG
ACCCCCACCCTCTATCACGGCTACTATGTTCGGCCTCGGGCCGCCAGAGCTGGCGAGGGCGCCAGGGCAG
GGGCCTCAGAGCTCAGGCTCAGTGAAGGCAAGTTCCAGGCGTTTCTGGATGTGAGCCACTTTACCCCAGA
TGAGGTGACGGTGAGGACTGTGGATAACCTGCTGGAGGTGTCTGCCCGACACCCCCAGCGTCTGGATCGC
CACGGCTTCGTGTCCCGAGAGTTCTGTCGCACCTATGTCCTGCCTGCAGATGTGGACCCCTGGCGGGTTC
GAGCTGCTCTATCCCATGATGGCATCCTTAACTTGGAGGCGCCGCGGGGTGGCCGGCATTTGGACACGGA
AGTCAATGAAGTCTACATCTCCCTGCTTCCTGCTCCTCCTGACCCCGAGGAAGAGGAAGAGATAGCCAGA
GTTGAGCCCTGACTGCCAGCGATAGACCCAGCACCCAGTGAATCCCCTGTCTACCTCCCGTGGTGATTCC
ATAAATCCACCACACCCCAGAGGGAGCAGCATCCCTGGGAGATGGCATCGGTGCATGGTCCACAGTGTAT
GGTTTGGTCCCTTGATGTATCAAAGCCTTTGATTTAATTCTGGGTGGGGCTGAATAAACCAAAACCTGGG
GGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:948723 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:948723 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11464 same embryo
 EMAGE:11466 same embryo
 EMAGE:11465 same embryo
 EurExpress:euxassay_006798 same experiment
 MGI:4825480 same experiment
 EMAGE:31879 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS