Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11528

Asf1a ASF1 anti-silencing function 1 homolog A (S. cerevisiae) ( MGI:1913653)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11528 EMAGE:11528 EMAGE:11528 EMAGE:11528 EMAGE:11528
"Pseudo-wholemount" of euxassay_006843. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006843_01 euxassay_006843_02 euxassay_006843_03 euxassay_006843_04
EMAGE:11528 EMAGE:11528 EMAGE:11528 EMAGE:11528 EMAGE:11528
euxassay_006843_05 euxassay_006843_06 euxassay_006843_07 euxassay_006843_08 euxassay_006843_09
EMAGE:11528 EMAGE:11528 EMAGE:11528 EMAGE:11528 EMAGE:11528
euxassay_006843_10 euxassay_006843_11 euxassay_006843_12 euxassay_006843_13 euxassay_006843_14
EMAGE:11528 EMAGE:11528 EMAGE:11528 EMAGE:11528 EMAGE:11528
euxassay_006843_15 euxassay_006843_16 euxassay_006843_17 euxassay_006843_18 euxassay_006843_19
EMAGE:11528 EMAGE:11528 EMAGE:11528 EMAGE:11528
euxassay_006843_20 euxassay_006843_21 euxassay_006843_22 euxassay_006843_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11528Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11528_wholemount_strong.wlz
11528_wholemount_moderate.wlz
11528_wholemount_weak.wlz
11528_wholemount_possible.wlz
11528_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11528_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 16 17 18 19 20
thyroid gland
weak weak
regionalweak expression: see section 10 11 15
vibrissa
weak weak
regionalweak expression: see section 06 07 08 09 21 22
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14 15
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 12 13 16 17 18
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 weak expression: see section 23
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 05 06 17 18 19 weak expression: see section 04 07 08 09 10 11 13 14 15 16 20
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 17 18 19 weak expression: see section 04 06 07 08 09 10 11 15 16 20
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 06 07 08 11 12 13 14 15 16
esophagus
moderate moderate
regionalmoderate expression: see section 12
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 16 17 weak expression: see section 13 15
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 16 17 weak expression: see section 13
renal cortex
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 16 17 18 19 20 21
left lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11
right lung
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T8204
Entity Detected:Asf1a, ASF1 anti-silencing function 1 homolog A (S. cerevisiae) ( MGI:1913653)
Sequence:sense strand is shown

>T8204
TGTTTGTGTTTTCTTCAAAATATGGCAAAGGTTCAGGTGAACAATGTAGTGGTGCTGGATAACCCGTCGC
CTTTCTACAACCCGTTCCAGTTCGAGATCACCTTCGAGTGCATCGAGGACCTGTCTGAAGACTTGGAGTG
GAAAATAATCTATGTGGGCTCTGCAGAAAGTGAAGAATACGATCAAGTTTTAGACTCTGTTTTAGTGGGT
CCCGTTCCTGCAGGAAGGCATATGTTTGTGTTTCAGGCTGATGCACCGAATGCAGGACTCATCCCAGATG
CAGATGCAGTGGGGGTAACAGTTGTTCTGATTACTTGCACCTACCGAGGTCAAGAATTTATTAGAGTTGG
CTACTATGTAAATAATGAATACACTGAAACAGAATTAAGGGAAAACCCACCAGTAAAACCAGACTTTTCT
AAGCTTCAAAGGAATATTTTGGCATCTAATCCCAGAGTCACAAGATTCCACATTAACTGGGAAGATAATA
CAGAAAAACTGGAAGATGCAGAGAGCAGTAACCCAAATCTACAGTCCCTTCTTTCAACAGATGCATTACC
GTCAGCGTCAAAGGGATGGTCCACGTCAGAAAACTCACTCAATGTTATGTTAGAATCCCACATGGACTGC
ATGTGACCACGTGCCATCCCATTAGTACAGATTAAGCTATTAAAAACAGAACTATTTCCCTGAAGTTCCG
TAAGTACATAGTCAACGTGAAATGTGAAGAATTTGTTTAAAAACATCCTGTAGAAAGTTTATAAGAAAAA
CCAGTATTTGAGCAAATTGTGGATTATAAATACAACTATTTTTAAGTACTTTTTTCTCTAATGTGTTATT
TTATTTGTTCATGAAACTAATCTGATTAAAGCATATATATTAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1178866 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:1178866 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11527 same embryo
 EurExpress:euxassay_006843 same experiment
 MGI:4823274 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS