Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11536

Plac9 placenta specific 9 ( MGI:2663998)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11536 EMAGE:11536 EMAGE:11536 EMAGE:11536 EMAGE:11536
"Pseudo-wholemount" of euxassay_006803. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006803_01 euxassay_006803_02 euxassay_006803_03 euxassay_006803_04
EMAGE:11536 EMAGE:11536 EMAGE:11536 EMAGE:11536 EMAGE:11536
euxassay_006803_05 euxassay_006803_06 euxassay_006803_07 euxassay_006803_08 euxassay_006803_09
EMAGE:11536 EMAGE:11536 EMAGE:11536 EMAGE:11536 EMAGE:11536
euxassay_006803_10 euxassay_006803_11 euxassay_006803_12 euxassay_006803_13 euxassay_006803_14
EMAGE:11536 EMAGE:11536 EMAGE:11536 EMAGE:11536 EMAGE:11536
euxassay_006803_15 euxassay_006803_16 euxassay_006803_17 euxassay_006803_18 euxassay_006803_19
EMAGE:11536 EMAGE:11536 EMAGE:11536 EMAGE:11536 EMAGE:11536
euxassay_006803_20 euxassay_006803_21 euxassay_006803_22 euxassay_006803_23 euxassay_006803_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11536Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11536_wholemount_strong.wlz
11536_wholemount_moderate.wlz
11536_wholemount_weak.wlz
11536_wholemount_possible.wlz
11536_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11536_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 10 11 18 19 20
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 07 08 09 10 11 12 15 19
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 11 15 16 weak expression: see section 07 08 09 10 18 19 20
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 19
esophagus
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 12
stomach
moderate moderate
regionalmoderate expression: see section 03 06 07 weak expression: see section 01 02 04 05
bladder
strong strong
regionalstrong expression: see section 12 13 14 15 moderate expression: see section 11
male reproductive system
weak weak
regionalweak expression: see section 10 14
trachea
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 14
axial skeleton
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 11 12
sternum
moderate moderate
regionalmoderate expression: see section 12 15 16 weak expression: see section 13 14
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T8248
Entity Detected:Plac9, placenta specific 9 ( MGI:2663998)
Sequence:sense strand is shown

>T8248
GGCTACGTACCATGCAGGCGCTGCTCTGCGCGCTAGCCGGGCTCGCCCTGCTCCGTGCCGGGACGGGCGA
ATGGGGCCAAGGTCCCAGGGACACCCCCGGACGGCGAGCTGCCGAGTCCCCCAGTTCCCCTGGAGATCTA
GCTGGGAGCCCAGGCTGTGACAGACACGCGGCTGTGCAAAGGCGGTTAGACATTATGGAGGAGACGGTGG
AGAAGACAGTGGAGCACCTGGAGGCGGAAGTGACAGGTCTGCTGGGCCTGCTGGAGGAACTGGCTTCAAA
CCTTCCCACAGGGCCCTTCAGCCCCAAACCTGACTTGCTTGGAGATGATGGTTTCTGACTTCCAGGGATG
GTGGAGCCTGCCAGCTGAAGTCATCCCTCAGAGAACCAAGCCAGGTCTTCCTGCCTTCCTGCCCCACCTT
TGTGTGAAATAAAAGCTCCGATTTGGACCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1348266 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:1348266 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11539 same embryo
 EMAGE:11540 same embryo
 EMAGE:11538 same embryo
 EMAGE:11535 same embryo
 EMAGE:11537 same embryo
 EurExpress:euxassay_006803 same experiment
 MGI:4827249 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS