EMAGE mouse gene expression spatial database

EMAGE:11559

Fam96b family with sequence similarity 96, member B ( MGI:1915773)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_006728. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_006728_01	euxassay_006728_02	euxassay_006728_03	euxassay_006728_04

euxassay_006728_05	euxassay_006728_06	euxassay_006728_07	euxassay_006728_08	euxassay_006728_09

euxassay_006728_10	euxassay_006728_11	euxassay_006728_12	euxassay_006728_13	euxassay_006728_14

euxassay_006728_15	euxassay_006728_16	euxassay_006728_17	euxassay_006728_18	euxassay_006728_19

euxassay_006728_20

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T7339
Entity Detected:	Fam96b, family with sequence similarity 96, member B ( MGI:1915773)
Sequence:	sense strand is shown >T7339 CGCGGTTCCGGGATGGTGGGCGGCGGCGGTAGCGGCGGCGGGCTCTTAGAGAACGCTAACCCCCTCATCT ATGAGCGTTCCGGGGAGCGGCCAGTGACGGCGGGCGAGGAAGATGAGGAAGTGCCGGACAGCATCGACGC CCGGGAGATCTTCGATCTTATCCGCTCCATTAATGACCCGGAGCATCCACTGACACTGGAGGAATTGAAC GTAGTAGAGCAAGTTCGGATTCAGGTTAGCGACCCAGAGAGCACAGTAGCAGTGGCCTTCACACCCACCA TCCCACACTGCAGCATGGCCACGCTTATTGGCCTCTCCATCAAAGTCAAGCTGCTGCGATCCCTTCCCCA GCGGTTCAAGATGGATGTACACATTACACCCGGGACCCACGCCTCCGAGCATGCAGTGAACAAACAACTT GCAGATAAGGAGCGAGTGGCAGCTGCCCTGGAGAATACACACCTGCTTGAGGTTGTTAATCAGTGTTTAT CCGCCCGCTCGTGAGCCTGGCTTTGGACCCCCAGCCTGCACTCAGGTTGTCCTGGCCTCAGCTCCACCAA GGGCTCATGGCTTTGTTTTCTTGAATCACTGACAAGGAGAAACTTAACACTTTTTATTTTGTAATAAACC CTTAATTTATATTCATTTCCCAGTAAAAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:4190754 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4190754 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:11557 same embryo
	EMAGE:11558 same embryo
	EurExpress:euxassay_006728 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source