Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11671

Cacnb3 calcium channel, voltage-dependent, beta 3 subunit ( MGI:103307)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11671 EMAGE:11671 EMAGE:11671 EMAGE:11671 EMAGE:11671
"Pseudo-wholemount" of euxassay_007145. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007145_01 euxassay_007145_02 euxassay_007145_03 euxassay_007145_04
EMAGE:11671 EMAGE:11671 EMAGE:11671 EMAGE:11671 EMAGE:11671
euxassay_007145_05 euxassay_007145_06 euxassay_007145_07 euxassay_007145_08 euxassay_007145_09
EMAGE:11671 EMAGE:11671 EMAGE:11671 EMAGE:11671 EMAGE:11671
euxassay_007145_10 euxassay_007145_11 euxassay_007145_12 euxassay_007145_13 euxassay_007145_14
EMAGE:11671 EMAGE:11671 EMAGE:11671 EMAGE:11671 EMAGE:11671
euxassay_007145_15 euxassay_007145_16 euxassay_007145_17 euxassay_007145_18 euxassay_007145_19
EMAGE:11671 EMAGE:11671 EMAGE:11671 EMAGE:11671 EMAGE:11671
euxassay_007145_20 euxassay_007145_21 euxassay_007145_22 euxassay_007145_23 euxassay_007145_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11671Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11671_wholemount_strong.wlz
11671_wholemount_moderate.wlz
11671_wholemount_weak.wlz
11671_wholemount_possible.wlz
11671_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11671_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
strong strong
regionalstrong expression: see section 17 moderate expression: see section 08 09
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 17 18 19
trigeminal v nerve
strong strong
regionalstrong expression: see section 10 11 18 19
spinal cord
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 11 13 14 15
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 16 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 11 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 13 15 16 17
not examined not examined
regionalnot examined expression: see section 01 02 03 04 24
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04
retina nuclear layer
strong strong
regionalstrong expression: see section 01 02 03 04 moderate expression: see section 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35118
Entity Detected:Cacnb3, calcium channel, voltage-dependent, beta 3 subunit ( MGI:103307)
Sequence:sense strand is shown

>T35118
GAGGACTATGCAGATGCCTACCAGGACCTGTACCAGCCTCACCGCCAACACACCTCGGGGCTGCCCAGTG
CTAACGGGCACGACCCCCAAGACCGGCTCCTAGCCCAGGACTCGGAGCATGACCACAATGACCGGAACTG
GCAGCGTAACCGGCCTTGGCCCAAGGACAGCTACTGACCACCTCCTGCCCCACCCTGGCAGGCGCAGGCA
CAGCGGCTGGGGTGTCCACCTCAGGCAGGTTGGAGTTAGATTGGCATTAGGCTGCCGTTAGTTCAGCTCA
CACAACCCTCTGCCCAGCCCCAGGTCCAGGGCTGACTGTGGTCCCAAGGTTCTGGGAGAAGCAAGGGGCC
CCTCACCTCCTGGGCACAGTGACCCCGTAGGTTCTCATCCGGGTACTAGCCGTGTTCTGCATCCTTGGCA
CCTCCCCCTGCATAAGCTGCCGCCCCCGTGGGCAACAATCTCAGGCCAGGATCACTTAGCAGGGGCCTTC
CAGCCAGAATGGATGCCCCTCTAAAGAGCAAGAGGGTGTGAGTGTGGGCAACATAGCCTGAGGAAGAAGA
AACTCGGTTCCTAAGCAGGTGTAGATCCTAAGCAAAGGGACTCCATTCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97469. Forward Primer - name:097469_F_cDNA_Cacnb3, sequence:GAGGACTATGCAGATGCCTACC; Reverse Primer - name:097469_N_SP6_cDNA_Cacnb3, sequence:GTGAATGGAGTCCCTTTGCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11672 same embryo
 EMAGE:11674 same embryo
 EMAGE:11673 same embryo
 EurExpress:euxassay_007145 same experiment
 MGI:4823583 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS