Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11674

Gabra1 gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 ( MGI:95613)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11674 EMAGE:11674 EMAGE:11674 EMAGE:11674 EMAGE:11674
"Pseudo-wholemount" of euxassay_008310. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008310_01 euxassay_008310_02 euxassay_008310_03 euxassay_008310_04
EMAGE:11674 EMAGE:11674 EMAGE:11674 EMAGE:11674 EMAGE:11674
euxassay_008310_05 euxassay_008310_06 euxassay_008310_07 euxassay_008310_08 euxassay_008310_09
EMAGE:11674 EMAGE:11674 EMAGE:11674 EMAGE:11674 EMAGE:11674
euxassay_008310_10 euxassay_008310_11 euxassay_008310_12 euxassay_008310_13 euxassay_008310_14
EMAGE:11674 EMAGE:11674 EMAGE:11674 EMAGE:11674 EMAGE:11674
euxassay_008310_15 euxassay_008310_16 euxassay_008310_17 euxassay_008310_18 euxassay_008310_19
EMAGE:11674 EMAGE:11674 EMAGE:11674 EMAGE:11674 EMAGE:11674
euxassay_008310_20 euxassay_008310_21 euxassay_008310_22 euxassay_008310_23 euxassay_008310_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11674Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11674_wholemount_strong.wlz
11674_wholemount_moderate.wlz
11674_wholemount_weak.wlz
11674_wholemount_possible.wlz
11674_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11674_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 08 09 10 18 19
telencephalon mantle layer
weak weak
regionalweak expression: see section 06 07 21
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 07 08 09 15 16 17 weak expression: see section 06 18
palatal shelf
weak weak
regionalweak expression: see section 11 12 13 14 15 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35162
Entity Detected:Gabra1, gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 ( MGI:95613)
Sequence:sense strand is shown

>T35162
CAGTCCAGAGCAGAGCAGAGTATTCAGCTCAGGGACAGGATTCTGAGAGGAAGCCAGGGAGCAAAAGCAT
GTCAGACGGAGATAGACAAGAGGAAGAGAGAGGGTAAGAAGGTCCAAAGATAGGAGAAAAAGTAGAAAAA
ACCAGAGCTTAACTGTAACCACAGAGTCATTTGTAGATATATATTTCCAAATATTCTAAAAAAATATATA
CGTCAAAAATATTTTTGTGTGAAAGTGTTTAAAAGGGCAAATAACAAATGTTTAATGAACTTTAAACCTA
TGTCTTTATTGCACAAATGATATAGTGTGCTTATGTTTTTATTCGTCAATGTTGAAGCTGATATATAGAT
TTAATGTTTTGTTTGTCAAATTAAAAATTCCCTAGGCTTTCTCTTTTTAAATTTCACTATGTAATATTTT
GTTGTTAAATGCTATTTTAGAATGTAAGAAAGCCTAACAAATAGGGCAAGGTGGGGCTATCACTGTAGCA
TTCTGAATCCAGTGTGGGGGAAACCCTTTCAATGGGCTACACTGCTGTCATCTGAACTTTTACCAGTAGA
CTCTATAGAGATCAGCCAGCCTAACACAGATGTTTACT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 94379. Forward Primer - name:094379_F_cDNA_Gabra1, sequence:CAGTCCAGAGCAGAGCAGAGTA; Reverse Primer - name:094379_N_SP6_cDNA_Gabra1, sequence:AGTAAACATCTGTGTTAGGCTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11671 same embryo
 EMAGE:11672 same embryo
 EMAGE:11673 same embryo
 EurExpress:euxassay_008310 same experiment
 MGI:4824962 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS