Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11715

Chrna3 cholinergic receptor, nicotinic, alpha polypeptide 3 ( MGI:87887)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11715 EMAGE:11715 EMAGE:11715 EMAGE:11715 EMAGE:11715
"Pseudo-wholemount" of euxassay_007155. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007155_01 euxassay_007155_02 euxassay_007155_03 euxassay_007155_04
EMAGE:11715 EMAGE:11715 EMAGE:11715 EMAGE:11715 EMAGE:11715
euxassay_007155_05 euxassay_007155_06 euxassay_007155_07 euxassay_007155_08 euxassay_007155_09
EMAGE:11715 EMAGE:11715 EMAGE:11715 EMAGE:11715 EMAGE:11715
euxassay_007155_10 euxassay_007155_11 euxassay_007155_12 euxassay_007155_13 euxassay_007155_14
EMAGE:11715 EMAGE:11715 EMAGE:11715 EMAGE:11715 EMAGE:11715
euxassay_007155_15 euxassay_007155_16 euxassay_007155_17 euxassay_007155_18 euxassay_007155_19
EMAGE:11715 EMAGE:11715 EMAGE:11715 EMAGE:11715 EMAGE:11715
euxassay_007155_20 euxassay_007155_21 euxassay_007155_22 euxassay_007155_23 euxassay_007155_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11715Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11715_wholemount_strong.wlz
11715_wholemount_moderate.wlz
11715_wholemount_weak.wlz
11715_wholemount_possible.wlz
11715_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11715_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 15 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 14 15 16 17 18 weak expression: see section 19
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 05 06 07 10 11 13 18
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 05 06 07 09 10 11 13 14 15
pons mantle layer
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 06
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 17 18 weak expression: see section 16
midbrain marginal layer
strong strong
regionalstrong expression: see section 12
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18 weak expression: see section 19
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 02 03 04 05 06 07 17 18 19 20 22
vagus x ganglion
weak weak
regionalweak expression: see section 08
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 07 17 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 16 17
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 10 moderate expression: see section 11 16 17
cervical ganglion
strong strong
regionalstrong expression: see section 09 moderate expression: see section 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 13 14
neural retina
strong strong
regionalstrong expression: see section 01 02 03 22 23 24
tongue
strong strong
spottedstrong expression: see section 14
stomach
strong strong
regionalstrong expression: see section 09 10 11 moderate expression: see section 01 02 03 04 05 06 07 08
hindgut
strong strong
regionalstrong expression: see section 13 14 15 16
midgut
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 07 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35140
Entity Detected:Chrna3, cholinergic receptor, nicotinic, alpha polypeptide 3 ( MGI:87887)
Sequence:sense strand is shown

>T35140
CTACAAGCTGAAATGGAAACCCTCTGACTACCAAGGGGTGGAGTTCATGCGAGTCCCTGCAGAGAAGATC
TGGAAACCAGACATCGTGCTTTACAACAACGCCGATGGGGATTTCCAAGTGGATGACAAAACCAAAGCTC
TACTCAAGTACACAGGAGAAGTGACTTGGATCCCTCCGGCCATCTTTAAGAGCTCATGCAAAATCGATGT
GACCTACTTCCCGTTTGACTACCAAAACTGCACCATGAAGTTCGGCTCCTGGTCCTACGACAAGGCAAAG
ATCGACCTGGTCCTCATTGGCTCCTCCATGAACCTCAAGGACTATTGGGAAAGTGGCGAGTGGGCCATCA
TTAAAGCCCCGGGCTACAAACATGAAATCAAGTACAACTGCTGTGAGGAGATCTACCAAGACATCACGTA
CTCGCTATACATTCGCCGCCTGCCGCTGTTCTACACCATCAACCTCATCATTCCGTGCCTGCTCATCTCC
TTCCTCACTGTGCTCGTCTTCTACCTGCCCTCCGACTGTGGGGAGAAGGTGACGCTCTGCATCTCCGTGC
TCCTCTCCCTGACGGTCTTTCTCCTCGTGATCACCGAGACCATTCCTTCCACCTCGCTGGTCATCCCCTT
GATCGGGGAGTACCTCCTCTTCACTATGATTTTTGTCACCTTGTCCATCGTCATCACAGTCTTTGTGCTC
AACGTGCACTACAGAACTCCGACCACACACACGAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 92639. Forward Primer - name:092639_F_cDNA_Chrna3, sequence:CTACAAGCTGAAATGGAAACCC; Reverse Primer - name:092639_N_SP6_cDNA_Chrna3, sequence:ATCGTGTGTGTGGTCGGAGTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11714 same embryo
 EurExpress:euxassay_007155 same experiment
 MGI:4823856 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS