Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11746

Clcn2 chloride channel 2 ( MGI:105061)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11746 EMAGE:11746 EMAGE:11746 EMAGE:11746 EMAGE:11746
"Pseudo-wholemount" of euxassay_008248. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008248_01 euxassay_008248_02 euxassay_008248_03 euxassay_008248_04
EMAGE:11746 EMAGE:11746 EMAGE:11746 EMAGE:11746 EMAGE:11746
euxassay_008248_05 euxassay_008248_06 euxassay_008248_07 euxassay_008248_08 euxassay_008248_09
EMAGE:11746 EMAGE:11746 EMAGE:11746 EMAGE:11746 EMAGE:11746
euxassay_008248_10 euxassay_008248_11 euxassay_008248_12 euxassay_008248_13 euxassay_008248_14
EMAGE:11746 EMAGE:11746 EMAGE:11746 EMAGE:11746 EMAGE:11746
euxassay_008248_15 euxassay_008248_16 euxassay_008248_17 euxassay_008248_18 euxassay_008248_19
EMAGE:11746 EMAGE:11746 EMAGE:11746 EMAGE:11746 EMAGE:11746
euxassay_008248_20 euxassay_008248_21 euxassay_008248_22 euxassay_008248_23 euxassay_008248_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11746Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11746_wholemount_strong.wlz
11746_wholemount_moderate.wlz
11746_wholemount_weak.wlz
11746_wholemount_possible.wlz
11746_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11746_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
foot
weak weak
regionalweak expression: see section 05
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 06 07 22 23 24
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 06 07 22 23 24
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 06 07 22 23 24
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 06 07 22 23 24
hindlimb digit 5 phalanx
weak weak
regionalweak expression: see section 06 07 22 23 24
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 07 08 16 17 18 19
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 06 07 08 16 17 18 19
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 22
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 01 02 09 10 11 12 13 14 15 weak expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 weak expression: see section 04 18 19
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 weak expression: see section 04 18 19
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 22
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 11 12 13 14 15 16 17 weak expression: see section 04 18 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 weak expression: see section 03 04 18 19
midbrain meninges
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 05 06 07 08 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 05 06 07 08 16 17 18 19
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 03 04 20
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 09 21 22 weak expression: see section 03 04 05 06 07 08 17 18 19 20
vagus x ganglion
weak weak
regionalweak expression: see section 07 17
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 05 06 07 08 17 18 19
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 17
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
spinal cord meninges
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 16 17 18
optic nerve
strong strong
regionalstrong expression: see section 09 10 11 16 17 18 19 20 21
neural retina
weak weak
regionalweak expression: see section 01 02 03 23 24
naris
moderate moderate
spottedmoderate expression: see section 12 13 14 15 16
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 05 06 07 10 11 13 14 15 16 17 18 19 21 22 weak expression: see section 04 08 09 12 20 23 24
renal capsule
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 18 19 20 21
testis
moderate moderate
regionalmoderate expression: see section 20
seminiferous cord
moderate moderate
regionalmoderate expression: see section 05 06 07 08 20 21 22
axial skeleton
moderate moderate
regionalmoderate expression: see section 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35146
Entity Detected:Clcn2, chloride channel 2 ( MGI:105061)
Sequence:sense strand is shown

>T35146
TATGTTGGCCCTAGTGGAGTCTCCTGAGTCCATGATCCTACTGGGATCCATCGAACGCTCACAGGTGGTA
GCACTACTAGGAGCCCAGCTGAGCCCAGCGCGCCGGCGGCAGCACATGCAAAAGCTAAGAAAAGCCCAGC
TGTCCTCACCGTCGGATCAAGAGAGCCCCCCCAGCTCCGAGACATCTATCCGCTTCCAGGTGAACACAGA
GGACTCGGGCTTCTCTGGAGCCCACGGGCAGACTCACAAGCCCCTGAAGCCTGCTCTAAAGAGAGGGCCC
AGCAACAGTACAAGCCTGCAGGAAGGTACCACAGGCAACATGGAGTCAGCAGGCATTGCCCTCAGAAGCC
TCTTCTGTGGCAGTCCACCTCTGGAGGCAACATCAGAATTGGAAAAGTCAGAATCCTGTGACAAGCGCAA
GCTGAAGCGGGTCCGAATCTCCCTGGCGAGTGACTCAGACCCGGAAGCCGAGATGAGTCCTGAGGAGATC
TTAGAGTGGGAAGAACAGCAGCTAGATGAGCCAGTCAACTTCAGTGACTGCAAAATCGACCCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74272. Forward Primer - name:074272_F_cDNA_Clcn2, sequence:TATGTTGGCCCTAGTGGAGTCT; Reverse Primer - name:074272_N_SP6_cDNA_Clcn2, sequence:CAGGGTCGATTTTGCAGTCAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11744 same embryo
 EMAGE:11745 same embryo
 EMAGE:11748 same embryo
 EMAGE:11747 same embryo
 EurExpress:euxassay_008248 same experiment
 MGI:4823899 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS