Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11747

Clcn6 chloride channel 6 ( MGI:1347049)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11747 EMAGE:11747 EMAGE:11747 EMAGE:11747 EMAGE:11747
"Pseudo-wholemount" of euxassay_008300. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008300_01 euxassay_008300_02 euxassay_008300_03 euxassay_008300_04
EMAGE:11747 EMAGE:11747 EMAGE:11747 EMAGE:11747 EMAGE:11747
euxassay_008300_05 euxassay_008300_06 euxassay_008300_07 euxassay_008300_08 euxassay_008300_09
EMAGE:11747 EMAGE:11747 EMAGE:11747 EMAGE:11747 EMAGE:11747
euxassay_008300_10 euxassay_008300_11 euxassay_008300_12 euxassay_008300_13 euxassay_008300_14
EMAGE:11747 EMAGE:11747 EMAGE:11747 EMAGE:11747 EMAGE:11747
euxassay_008300_15 euxassay_008300_16 euxassay_008300_17 euxassay_008300_18 euxassay_008300_19
EMAGE:11747 EMAGE:11747 EMAGE:11747 EMAGE:11747 EMAGE:11747
euxassay_008300_20 euxassay_008300_21 euxassay_008300_22 euxassay_008300_23 euxassay_008300_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11747Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11747_wholemount_strong.wlz
11747_wholemount_moderate.wlz
11747_wholemount_weak.wlz
11747_wholemount_possible.wlz
11747_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11747_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 09 15 16 weak expression: see section 08
pons mantle layer
weak weak
regionalweak expression: see section 06 17
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 05 21 weak expression: see section 04
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 weak expression: see section 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 05 06 07 09 21 22 weak expression: see section 04 08 17 18 19 20
vagus x ganglion
weak weak
regionalweak expression: see section 08 16 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 07
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 17
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 09 10 16
cervical ganglion
weak weak
regionalweak expression: see section 09 16
thoracic ganglion
weak weak
regionalweak expression: see section 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 09 10 11 12 13 18 weak expression: see section 08 16 17
neural retina
moderate moderate
spottedmoderate expression: see section 01 02 weak expression: see section 03 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35147
Entity Detected:Clcn6, chloride channel 6 ( MGI:1347049)
Sequence:sense strand is shown

>T35147
CACCTCTATTCTGGGACCTTTGCCCTGATTGGTGCGGCAGCTTTCTTGGGTGGGGTTGTAAGGATGACCA
TCAGCCTCACAGTCATCCTGATCGAGTCTACAAATGAGATCACCTATGGGCTTCCGATCATGGTCACTCT
GATGGTGGCCAAGTGGACTGGAGACTTGTTCAACAAGGGCATTTATGACGTCCACATTGGGCTGAGAGGT
GTGCCTCTTCTGGAGTGGGAGACAGACGTGGAAATGGACAAGCTGAGAGCCAGTGACATCATGGAGCCCA
ACCTGACGTACGTCTACCCGCACACTCGCATCCAGTCTCTGGTGAGCATCCTGCGCACTACGGTCCACCA
TGCCTTCCCAGTGGTTACGGAGAACCGGGGCAACGAGAAGGAGTTCATGAAGGGCAACCAGCTCATAAGC
AACAACATCAAGTTCAAGAAATCCAGTATCCTGACCCGTGCTGGTGAGCAGCGCAAGCGGGGCCAGTCCA
TGAAGTCGTACCCTTCCAGCGAGCTGCGCAACGTGTGTGATGAGCACGTGGCTTCCGAGGAGCCGGCAGA
GAAGGAGGACCTGCTACAGCAGATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74622. Forward Primer - name:074622_F_cDNA_Clcn6, sequence:CACCTCTATTCTGGGACCTTTG; Reverse Primer - name:074622_N_SP6_cDNA_Clcn6, sequence:CATCTGCTGTAGCAGGTCCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11744 same embryo
 EMAGE:11746 same embryo
 EMAGE:11745 same embryo
 EMAGE:11748 same embryo
 EurExpress:euxassay_008300 same experiment
 MGI:4823901 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS