Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11757

Gpatch3 G patch domain containing 3 ( MGI:2442492)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11757 EMAGE:11757 EMAGE:11757 EMAGE:11757 EMAGE:11757
"Pseudo-wholemount" of euxassay_010966. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010966_01 euxassay_010966_02 euxassay_010966_03 euxassay_010966_04
EMAGE:11757 EMAGE:11757 EMAGE:11757 EMAGE:11757 EMAGE:11757
euxassay_010966_05 euxassay_010966_06 euxassay_010966_07 euxassay_010966_08 euxassay_010966_09
EMAGE:11757 EMAGE:11757 EMAGE:11757 EMAGE:11757 EMAGE:11757
euxassay_010966_10 euxassay_010966_11 euxassay_010966_12 euxassay_010966_13 euxassay_010966_14
EMAGE:11757 EMAGE:11757 EMAGE:11757 EMAGE:11757 EMAGE:11757
euxassay_010966_15 euxassay_010966_16 euxassay_010966_17 euxassay_010966_18 euxassay_010966_19
EMAGE:11757 EMAGE:11757 EMAGE:11757 EMAGE:11757
euxassay_010966_20 euxassay_010966_21 euxassay_010966_22 euxassay_010966_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11757Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11757_wholemount_strong.wlz
11757_wholemount_moderate.wlz
11757_wholemount_weak.wlz
11757_wholemount_possible.wlz
11757_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11757_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 06 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
weak weak
regionalweak expression: see section 16
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 07 16
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 16 17
neural retina
weak weak
regionalweak expression: see section 01 02
left lung
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 11 12
right lung
strong strong
spottedstrong expression: see section 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36256
Entity Detected:Gpatch3, G patch domain containing 3 ( MGI:2442492)
Sequence:sense strand is shown

>T36256
TTAAGACCCGGAAGGAACTACAGAGTCGAAGGGCGGAGAATGAAGCTTTTACCCTGGCTGACCTGAAGCA
GCTCCCGGAGCTGAATCCGCCAGTGCTGATGCCCAATGGCAATGTGGGCACCCCCCTGCGGGTCTTTTTA
GAGTTGATCCGGTCCTGCCGTCTACCACCTAGAATCATTACCCAGCTACAGCTCCAGTTTCCCAAGACCG
GCTCCTCCCGGCGCTATGGCAACGTGCCCTTTCTGTATGAGGACTCAGAGACTGTGGAGCAAGAAGAGCA
CGTGTACACAGCAGAAGGGGAGGAGATCCCCCAGGGGAGCTGCTCGGAAGATCCAGCAGCTGGCTCCTTT
GATGAGCCGGAGGATGAAGGGCAGCAGCAGGAGGAGGAGGAGGAGTCTGGCTCAGAAGAGGACGATGACC
GGGGTGAGGAGTGGGAGCGACACGAAGCTCTGCACGAGGATGTGACCGGGCAGGAGCGGACTACAGAGCG
GCTCTTCGAGGAGGAGATTGAACTTAAGTGGGAGAAAGGTGGCTCTGGCCTCGTGTTCTACACCGACGCT
CAGTTCTGGCAGGAGGAGGAAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 101859. Forward Primer - name:101859_F_cDNA_D930035B09Rik, sequence:TTAAGACCCGGAAGGAACTACA; Reverse Primer - name:101859_N_SP6_cDNA_D930035B09Rik, sequence:CTTCCTCCTCCTGCCAGAACT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11756 same embryo
 EMAGE:11758 same embryo
 EMAGE:11755 same embryo
 EMAGE:11759 same embryo
 EurExpress:euxassay_010966 same experiment
 MGI:4825153 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS