Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11772

Kcnj5 potassium inwardly-rectifying channel, subfamily J, member 5 ( MGI:104755)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11772 EMAGE:11772 EMAGE:11772 EMAGE:11772 EMAGE:11772
"Pseudo-wholemount" of euxassay_008323. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008323_01 euxassay_008323_02 euxassay_008323_03 euxassay_008323_04
EMAGE:11772 EMAGE:11772 EMAGE:11772 EMAGE:11772 EMAGE:11772
euxassay_008323_05 euxassay_008323_06 euxassay_008323_07 euxassay_008323_08 euxassay_008323_09
EMAGE:11772 EMAGE:11772 EMAGE:11772 EMAGE:11772 EMAGE:11772
euxassay_008323_10 euxassay_008323_11 euxassay_008323_12 euxassay_008323_13 euxassay_008323_14
EMAGE:11772 EMAGE:11772 EMAGE:11772 EMAGE:11772 EMAGE:11772
euxassay_008323_15 euxassay_008323_16 euxassay_008323_17 euxassay_008323_18 euxassay_008323_19
EMAGE:11772 EMAGE:11772 EMAGE:11772 EMAGE:11772
euxassay_008323_20 euxassay_008323_21 euxassay_008323_22 euxassay_008323_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11772Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11772_wholemount_strong.wlz
11772_wholemount_moderate.wlz
11772_wholemount_weak.wlz
11772_wholemount_possible.wlz
11772_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11772_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
liver left lobe
weak weak
single cellweak expression: see section 01 02 03 04 05 06 07 08 09 10 11
liver right lobe
moderate moderate
single cellmoderate expression: see section 13 14 17 18 19 20 21 22 23 weak expression: see section 12 15 16 not examined expression: see section 06 07 08 09 10 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35249
Entity Detected:Kcnj5, potassium inwardly-rectifying channel, subfamily J, member 5 ( MGI:104755)
Sequence:sense strand is shown

>T35249
GACCACAAGAAGATTCCCAAACAGGCTCGGGATTACATCCCCATTGCCACAGACCGCACCCGCCTGTTGA
CAGAAGGCAAGAAGCCACGCCAGCGCTACATGGAGAAGACTGGCAAGTGCAATGTACACCACGGTAATGT
TCAGGAAACCTACCGTTACCTAAGTGACCTCTTCACCACCCTGGTGGACCTCAAATGGCGCTTCAACCTT
CTGGTCTTCACCATGGTCTACACCATCACCTGGGTGTTCTTTGGCTTCATTTGGGGGCTCATTGCTTATG
TCCGAGGTGATCTGGATCACGTGGGTGACCAAGAGTGGATCCCTTGTGTTGAAAACCTTAGCGGCTTTGT
ATCTGCTTTCCTGTTCTCCATCGAGACAGAAACAACCATTGGGTATGGCTTCAGAGTCATTACAGAGAAG
TGTCCAGAAGGGATCATACTCCTTCTGGTGCAGGCCATTCTGGGCTCGATTGTTAATGCCTTCATGGTGG
GGTGCATGTTTGTAAAGATCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 92214. Forward Primer - name:092214_F_cDNA_Kcnj5, sequence:GACCACAAGAAGATTCCCAAAC; Reverse Primer - name:092214_N_SP6_cDNA_Kcnj5, sequence:CTGATCTTTACAAACATGCACCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11773 same embryo
 EMAGE:11771 same embryo
 EMAGE:11774 same embryo
 EurExpress:euxassay_008323 same experiment
 MGI:4825722 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS