Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11774

Klhl1 kelch-like 1 (Drosophila) ( MGI:2136335)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11774 EMAGE:11774 EMAGE:11774 EMAGE:11774 EMAGE:11774
"Pseudo-wholemount" of euxassay_011007. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011007_01 euxassay_011007_02 euxassay_011007_03 euxassay_011007_04
EMAGE:11774 EMAGE:11774 EMAGE:11774 EMAGE:11774 EMAGE:11774
euxassay_011007_05 euxassay_011007_06 euxassay_011007_07 euxassay_011007_08 euxassay_011007_09
EMAGE:11774 EMAGE:11774 EMAGE:11774 EMAGE:11774 EMAGE:11774
euxassay_011007_10 euxassay_011007_11 euxassay_011007_12 euxassay_011007_13 euxassay_011007_14
EMAGE:11774 EMAGE:11774 EMAGE:11774 EMAGE:11774 EMAGE:11774
euxassay_011007_15 euxassay_011007_16 euxassay_011007_17 euxassay_011007_18 euxassay_011007_19
EMAGE:11774 EMAGE:11774 EMAGE:11774 EMAGE:11774 EMAGE:11774
euxassay_011007_20 euxassay_011007_21 euxassay_011007_22 euxassay_011007_23 euxassay_011007_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11774Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11774_wholemount_strong.wlz
11774_wholemount_moderate.wlz
11774_wholemount_weak.wlz
11774_wholemount_possible.wlz
11774_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11774_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 08 09 10 11 12 moderate expression: see section 07 13 14 15
telencephalon mantle layer
moderate moderate
single cellmoderate expression: see section 01 02 03 04 19 20 21 23
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 06 07 10 11 14 15 17 moderate expression: see section 08 09 12 13 16
pons mantle layer
strong strong
single cellstrong expression: see section 05 06 07 10 11 14 15 17 18 moderate expression: see section 08 09 12 13 16
midbrain mantle layer
strong strong
single cellstrong expression: see section 08 09 10 12 moderate expression: see section 05 06 07 13 14 15 17
ventral grey horn
strong strong
single cellstrong expression: see section 09 10 13 14 15 moderate expression: see section 11 12
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 05 06 07 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36555
Entity Detected:Klhl1, kelch-like 1 (Drosophila) ( MGI:2136335)
Sequence:sense strand is shown

>T36555
GGGAGAAAAGACTTCGATGTGAAGCACATCCTGCGACTCCGCTGGAAACTCTTCAGCCATCCCTCGCCGG
CCTCCAGTAGCCCAGCGGGGGGCAGCTGCCTGCAACAGGACAGCGGAGGAGGCAGCTTTGAGCACTGGGG
TCCTAGCCAGAGTCGGCTGCTCAAAAACCAGGAAAAGGGCAGTGTGAGCGCTTTCTGGAAAAAGCCTTCT
TCCTCCTCTTCCTCCTCCTCTTCCTCCTCGTCTTCTGCTTCATCTTCTCCTTTCAATCCGCTGAATGGCA
CCTTACTACCAGTTGCCACGAGGCTGCAGCAAGGGGCTCCCGGGCAGGGCACCCAGCAGCCCGCCAGGAC
TCTTTTCTACGTGGAGTCCCTAGAGGAGGAGGTAGTGACAGGCATGGACTTTCCTGGACCACAGGACAAA
GGATTGGCCCTGAAAGAGCTCCAAGCGGAGCCTGCCAGCTCTATCCAGGCAACAGGTGAAGGATGTGGAC
ACAGGTTGACATCGACCAATCATTCACTGACACCTCAAAGTGATTTGGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66475. Forward Primer - name:066475_F_cDNA_Klhl1, sequence:GGGAGAAAAGACTTCGATGTGA; Reverse Primer - name:066475_N_SP6_cDNA_Klhl1, sequence:TCCAAATCACTTTGAGGTGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11773 same embryo
 EMAGE:11772 same embryo
 EMAGE:11771 same embryo
 EurExpress:euxassay_011007 same experiment
 MGI:4825792 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS