EMAGE mouse gene expression spatial database

EMAGE:11827

Rps26 ribosomal protein S26 ( MGI:1351628)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_007095. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_007095_01	euxassay_007095_02	euxassay_007095_03	euxassay_007095_04

euxassay_007095_05	euxassay_007095_06	euxassay_007095_07	euxassay_007095_08	euxassay_007095_09

euxassay_007095_10	euxassay_007095_11	euxassay_007095_12	euxassay_007095_13	euxassay_007095_14

euxassay_007095_15	euxassay_007095_16	euxassay_007095_17	euxassay_007095_18	euxassay_007095_19

euxassay_007095_20	euxassay_007095_21	euxassay_007095_22	euxassay_007095_23	euxassay_007095_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

embryo

strong

ubiquitous

strong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T4596
Entity Detected:	Rps26, ribosomal protein S26 ( MGI:1351628)
Sequence:	sense strand is shown >T4596 CCACGCGTCCGAAGATGACCAAAAAAAGAAGAAACAACGGTCGCGCCAAAAAGGGCCGCGGCCATGTGCA GCCCATTCGCTGCACGAACTGCGCCCGGTGCGTGCCCAAGGATAAGGCCATCAAGAAGTTTGTCATTCGG AACATTGTAGAAGCCGCTGCTGTCAGGGACATATCTGAAGCAAGCGTCTTCGACGCCTACGTGCTTCCCA AGCTCTATGTCAAGCTGCATTATTGCGTGAGCTGTGCCATCCATAGCAAGGTTGTTAGGAATCGATCCCG CGAGGCCCGGAAGGACCGAACACCCCCACCACGATTCAGACCTGCTGGCGCTGCACCTCGACCTCCACCA AAGCCCATGTAAAGAGGCCGTTTTGTAAGGACGGAAGGAAAATTACCCTGGAAAAATAAAATGGAAGTTG TACTTTAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:	The probe template was PCR amplified from IMAGE:4987659 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4987659 which was retrieved directly from NCBI.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:11826 same embryo
	EMAGE:11825 same embryo
	EMAGE:11829 same embryo
	EMAGE:11824 same embryo
	EMAGE:11828 same embryo
	EurExpress:euxassay_007095 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source