Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11882

Cd82 CD82 antigen ( MGI:104651)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11882 EMAGE:11882 EMAGE:11882 EMAGE:11882 EMAGE:11882
"Pseudo-wholemount" of euxassay_011073. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011073_01 euxassay_011073_02 euxassay_011073_03 euxassay_011073_04
EMAGE:11882 EMAGE:11882 EMAGE:11882 EMAGE:11882 EMAGE:11882
euxassay_011073_05 euxassay_011073_06 euxassay_011073_07 euxassay_011073_08 euxassay_011073_09
EMAGE:11882 EMAGE:11882 EMAGE:11882 EMAGE:11882 EMAGE:11882
euxassay_011073_10 euxassay_011073_11 euxassay_011073_12 euxassay_011073_13 euxassay_011073_14
EMAGE:11882 EMAGE:11882 EMAGE:11882 EMAGE:11882 EMAGE:11882
euxassay_011073_15 euxassay_011073_16 euxassay_011073_17 euxassay_011073_18 euxassay_011073_19
EMAGE:11882 EMAGE:11882 EMAGE:11882 EMAGE:11882 EMAGE:11882
euxassay_011073_20 euxassay_011073_21 euxassay_011073_22 euxassay_011073_23 euxassay_011073_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11882Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11882_wholemount_strong.wlz
11882_wholemount_moderate.wlz
11882_wholemount_weak.wlz
11882_wholemount_possible.wlz
11882_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11882_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 22 23 24
upper leg muscle
moderate moderate
regionalmoderate expression: see section 04 05 06 07 22 23 24
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01
foot
moderate moderate
regionalmoderate expression: see section 23
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 17 18 19 20 21 22 23 24
thymus primordium
strong strong
regionalstrong expression: see section 11 13 14 15 moderate expression: see section 12
diencephalon meninges
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
lateral ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 13 14 15 16 17 18 19 weak expression: see section 11 12
telencephalon meninges
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hindbrain meninges
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 13 14 15 16 17 18 19 20 21 22 weak expression: see section 03 04 11 12
midbrain meninges
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
spinal cord meninges
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16 17
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 14 15 moderate expression: see section 16 17 18 weak expression: see section 07 08 09 10 11
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 13 14 weak expression: see section 09 12
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 22 23 24 weak expression: see section 12
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36537
Entity Detected:Cd82, CD82 antigen ( MGI:104651)
Sequence:sense strand is shown

>T36537
GCTTCATTTCCGTCCTACAAACCTCATCCAGCTCGCTGCAGGTGGGGGCTTACGTCTTCATCGGTGTGGG
CGCCATCACCATAGTGATGGGCTTCCTGGGCTGTATCGGTGCTGTCAATGAGGTCCGCTGCTTGCTGGGT
CTGTACTTTGTCTTCCTTCTGCTGATCCTCATCGCACAGGTGACCGTAGGGGTCCTCTTCTACTTCAACG
CTGACAAGCTGAAGAAGGAGATGGGGAACACAGTGATGGACATCATTCGCAACTACACTGCCAATGCCAC
CAGTAGCCGCGAGGAGGCCTGGGACTACGTGCAGGCGCAGGTCAAGTGCTGTGGCTGGGTCAGCCACTAC
AACTGGACAGAGAACGAGGAGCTCATGGGCTTTACCAAGACCACTTACCCATGCTCCTGCGAGAAGATCA
AGGAAGAGGACAACCAGCTCATTGTGAAGAAAGGATTCTGTGAGGCTGATAACAGCACTGTGAGCGAAAA
CAACCCTGAGGATTGGCCTGTGAACACTGAGGGCTGCATGGAGAAGGCGCAGGCGTGGCTTCAGGAGAAC
TTCGGCATCCTTCTGGGCGTGTGTGCTGGTGTTGCTGTCATTGAGCTGCTGGGGTTGTTCCTGTCCATAT
GTTTGTGCCGGTACATTCATTCTGAAGACTACAGCAAGGTCCCCAAGTACTGAGGTTGCTGATGTCCCCA
CCGTCCTATTTCTCCACCCTCAGCCTCCCATGGGGCCTCTCTAGCTTTTTCTCACATGGGCCCTGCTCCA
TCCACCACTGAGGCCTCTGGCCATCCTGGAAAGGTTGCATTGGGAACTTTCTGGGCCTGGGCCCTTCTCC
CTGTCCTTCTGCCACCAATATGGGGCCCTGGCTATCCTGTGGCCTTTCTTCCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97519. Forward Primer - name:097519_F_cDNA_Kai1, sequence:GCTTCATTTCCGTCCTACAAAC; Reverse Primer - name:097519_N_SP6_cDNA_Kai1, sequence:AGGAAGAAAGGCCACAGGATAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11884 same embryo
 EMAGE:11887 same embryo
 EMAGE:11885 same embryo
 EMAGE:11886 same embryo
 EMAGE:11883 same embryo
 EurExpress:euxassay_011073 same experiment
 MGI:4823745 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS