Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11883

Mdga1 MAM domain containing glycosylphosphatidylinositol anchor 1 ( MGI:1922012)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11883 EMAGE:11883 EMAGE:11883 EMAGE:11883 EMAGE:11883
"Pseudo-wholemount" of euxassay_011139. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011139_01 euxassay_011139_02 euxassay_011139_03 euxassay_011139_04
EMAGE:11883 EMAGE:11883 EMAGE:11883 EMAGE:11883 EMAGE:11883
euxassay_011139_05 euxassay_011139_06 euxassay_011139_07 euxassay_011139_08 euxassay_011139_09
EMAGE:11883 EMAGE:11883 EMAGE:11883 EMAGE:11883 EMAGE:11883
euxassay_011139_10 euxassay_011139_11 euxassay_011139_12 euxassay_011139_13 euxassay_011139_14
EMAGE:11883 EMAGE:11883 EMAGE:11883 EMAGE:11883 EMAGE:11883
euxassay_011139_15 euxassay_011139_16 euxassay_011139_17 euxassay_011139_18 euxassay_011139_19
EMAGE:11883 EMAGE:11883 EMAGE:11883 EMAGE:11883 EMAGE:11883
euxassay_011139_20 euxassay_011139_21 euxassay_011139_22 euxassay_011139_23 euxassay_011139_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11883Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11883_wholemount_strong.wlz
11883_wholemount_moderate.wlz
11883_wholemount_weak.wlz
11883_wholemount_possible.wlz
11883_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11883_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 15 16 17 18
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16 17 18 19
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 15 16 17 18
medulla oblongata alar plate mantle layer
moderate moderate
single cellmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19
medulla oblongata alar plate marginal layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 moderate expression: see section 16
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 13 14 15 16 17 18 19 weak expression: see section 12
medulla oblongata basal plate marginal layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 13 14 17 18 19 moderate expression: see section 12 15 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 19 20
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21 weak expression: see section 12
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
facial vii ganglion
moderate moderate
spottedmoderate expression: see section 04 05 06 07 21 22
glossopharyngeal ix ganglion
moderate moderate
spottedmoderate expression: see section 19 20
trigeminal v ganglion
moderate moderate
spottedmoderate expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
moderate moderate
spottedmoderate expression: see section 09 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 18 19 20 21
spinal cord mantle layer
moderate moderate
single cellmoderate expression: see section 11 12 13 14 15 16 17 18 19
dorsal root ganglion
moderate moderate
spottedmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36626
Entity Detected:Mdga1, MAM domain containing glycosylphosphatidylinositol anchor 1 ( MGI:1922012)
Sequence:sense strand is shown

>T36626
GTTGCAAAGATGATGAGAGCTGTGTGGCCCCCACCCCGCCCTGCCCCCGGCACACCAAAGTGTCCACATC
GTACCAAAGACTGACCCCTGCCAGCCGGGGTGCCTAGGGGCGGGGCCAGCCCACCAGGGAGGGGGCCTTC
ATTGGCTACATTGATGAGCAGAGAACTCGGACAGAGGCCAAGCCAGGCTCTGGTGGTTGTTCAACACACG
CACACACTCACACTCACTCTCACCACAGATATATTAAAGCACAAGTTTTTATTCGACCTGCCAGCACCTT
CTTTACTGTGGAGATGGGACTTATGTGAATGGCGTCCACCACCTCCAGGGACCTTGGTGCGACACGGGAC
TCATCTTGTCTGCACACTGCGCTGTGTCTGTCTGACCTTGCCTTGTCCCCTGACTCAAGGCCGAACTCCA
GCCCAGAGGCTTGCCAGAAGGGAGCCGGATGTGGGCAGAATATCAGACTTGGGCTGCCTGGATGGAGGTC
ACAGGGTGCAGAGGCAGGCCAGTCGGGACTCCGTGAGCTCTCCGACTGCCCCTTGATCAGAGGCTGACAA
GGAAGGGGCACCTGCTGCAGAGTGGACACATTGCTCAACTCAGATCCCCCGACCTGTTCCTAGGACTCCC
TCTTGCCCTCCCCACTGTACCCACTTGGGAGGGCCCGCAGCACAGGGCTTAGGGTATGTGCAGTATGAGG
ACTCTCTCCCACC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 85356. Forward Primer - name:085356_F_cDNA_Mdga1, sequence:GTTGCAAAGATGATGAGAGCTG; Reverse Primer - name:085356_N_SP6_cDNA_Mdga1, sequence:GGTGGGAGAGAGTCCTCATACT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11882 same embryo
 EMAGE:11884 same embryo
 EMAGE:11887 same embryo
 EMAGE:11885 same embryo
 EMAGE:11886 same embryo
 EurExpress:euxassay_011139 same experiment
 MGI:4826141 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS