Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11888

Kif21b kinesin family member 21B ( MGI:109234)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11888 EMAGE:11888 EMAGE:11888 EMAGE:11888 EMAGE:11888
"Pseudo-wholemount" of euxassay_011005. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011005_01 euxassay_011005_02 euxassay_011005_03 euxassay_011005_04
EMAGE:11888 EMAGE:11888 EMAGE:11888 EMAGE:11888 EMAGE:11888
euxassay_011005_05 euxassay_011005_06 euxassay_011005_07 euxassay_011005_08 euxassay_011005_09
EMAGE:11888 EMAGE:11888 EMAGE:11888 EMAGE:11888 EMAGE:11888
euxassay_011005_10 euxassay_011005_11 euxassay_011005_12 euxassay_011005_13 euxassay_011005_14
EMAGE:11888 EMAGE:11888 EMAGE:11888 EMAGE:11888 EMAGE:11888
euxassay_011005_15 euxassay_011005_16 euxassay_011005_17 euxassay_011005_18 euxassay_011005_19
EMAGE:11888 EMAGE:11888 EMAGE:11888 EMAGE:11888 EMAGE:11888
euxassay_011005_20 euxassay_011005_21 euxassay_011005_22 euxassay_011005_23 euxassay_011005_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11888Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11888_wholemount_strong.wlz
11888_wholemount_moderate.wlz
11888_wholemount_weak.wlz
11888_wholemount_possible.wlz
11888_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11888_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
forebrain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 22 23 24 moderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
hindbrain
strong strong
regionalstrong expression: see section 02 03 04 05 moderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 03 04 20 21
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 17 18 19 weak expression: see section 03 04 20 21 22
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 17 18
spinal cord
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 07 08 09 10 11 15 16
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 03 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36548
Entity Detected:Kif21b, kinesin family member 21B ( MGI:109234)
Sequence:sense strand is shown

>T36548
GACGCACTATGTACACTGGGAACTATTAATTTACTCCTTGTGCCCCTCCTAGGACTTGAGGCCCAGGCCA
CATCTGTATCCTGTGGGGGTCCTCTCTAGACCTGCACACCCCAAGCCTTTAACAACCAGAGTATAGCTGG
TACCTGACCCTACTGAGCCTGAAGAGCCTGGACCCAGACTCCCATCTCTTGAGCTAACCCCGACATCCTT
GCTTCCGATATTGATTAGCTTCCATGGAAAGTGTCTACTGTCCCCACTCTCTTAGGTCTTTTCTGTGCAC
AGTCCTGGGCCAGGACCCATCCCAGTATTAACCAGTTCAGTGTTTGGTCTTGTTGGTGAGACTTGGTCCG
ACAGCAGCCAACTCAATGCACATGCTGCCTGGAGCAGCCTTTAGAGACTGCAGAGGAAAGAGAGAGAACT
CGAAGAATGAGAGGCTGACCCAGCGCAGCCCTTGATGTGGTCAGAGTGCCACCACAGCTACTTGAAAAGG
GACAGCTATGGACCTGGGAGTAGCCTCCCACCGTTGCTCCAGCTGCAGGCCTGGAATGGTCTTAGGCTGT
GTGGCTTGGGCAAAGGGCAGCTTAAAGCACAAACAAGGAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 95714. Forward Primer - name:095714_F_cDNA_Kif21b, sequence:GACGCACTATGTACACTGGGAA; Reverse Primer - name:095714_N_SP6_cDNA_Kif21b, sequence:CTCCTTGTTTGTGCTTTAAGCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11889 same embryo
 EurExpress:euxassay_011005 same experiment
 MGI:4825758 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS