Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11964

Fam171b family with sequence similarity 171, member B ( MGI:2444579)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11964 EMAGE:11964 EMAGE:11964 EMAGE:11964 EMAGE:11964
"Pseudo-wholemount" of euxassay_008581. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008581_01 euxassay_008581_02 euxassay_008581_03 euxassay_008581_04
EMAGE:11964 EMAGE:11964 EMAGE:11964 EMAGE:11964 EMAGE:11964
euxassay_008581_05 euxassay_008581_06 euxassay_008581_07 euxassay_008581_08 euxassay_008581_09
EMAGE:11964 EMAGE:11964 EMAGE:11964 EMAGE:11964 EMAGE:11964
euxassay_008581_10 euxassay_008581_11 euxassay_008581_12 euxassay_008581_13 euxassay_008581_14
EMAGE:11964 EMAGE:11964 EMAGE:11964 EMAGE:11964 EMAGE:11964
euxassay_008581_15 euxassay_008581_16 euxassay_008581_17 euxassay_008581_18 euxassay_008581_19
EMAGE:11964 EMAGE:11964 EMAGE:11964 EMAGE:11964 EMAGE:11964
euxassay_008581_20 euxassay_008581_21 euxassay_008581_22 euxassay_008581_23 euxassay_008581_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11964Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11964_wholemount_strong.wlz
11964_wholemount_moderate.wlz
11964_wholemount_weak.wlz
11964_wholemount_possible.wlz
11964_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11964_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
olfactory cortex mantle layer
moderate moderate
single cellmoderate expression: see section 11 12 13 16 17 18 19 20
olfactory cortex ventricular layer
moderate moderate
single cellmoderate expression: see section 11 12 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 15 weak expression: see section 08 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 17 weak expression: see section 06
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17 18
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 10 17 18
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 09 10 11 12 13 15 16 17 18 weak expression: see section 08
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 11 12 13 14 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36243
Entity Detected:Fam171b, family with sequence similarity 171, member B ( MGI:2444579)
Sequence:sense strand is shown

>T36243
TTACAGGGACCGAAGAGGTCTATGGGCGGTCCCACATTCCCGAGCAGCTCATGCACATCTACAGCCAGCC
TATTGCCATCCTTCAGACATCAGACCTTTTCTCCATGCCAGAGCAGTTACATGCCGCTAAGTCTGCCACT
TTACCAAGAAAGGGACAATTGGTCTATGGCCAATTGATGGAACCAGTGAACAGAGAGAACTTTACACAAA
CATTGCCCAAAATGCCGATGCATTCTCACGTCCAGGCCCCAGATGCCAGAGAAGAAGACATTGTACTTGA
AGGTCAGCAGAGCTTGCCATCCCAGACCTCAGATTGGAGCCGATATTCCAACAGCTTGTTGGAGTCTGTG
TCTGTTCCTGGAACTCTAAATGAAGCTGTGGTGATGACCCCCTTTTCATCGGAACTTCAAGGAATTTCAG
AGCAGACCCTCCTGGAGCTGTCCAAAGGCAAGCCTCCGCATCCCAGGGCTTGGTTTGTGTCTCTTGATGG
AAAGCCTGTGGCCCAAGTGAGACACTCCTTTATAGACCTGAAAAAAGGCAAGAGAACCCAGAGCAATGAT
ACGAGTCTAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 68812. Forward Primer - name:068812_F_cDNA_D430039N05Rik, sequence:TTACAGGGACCGAAGAGGTCTA; Reverse Primer - name:068812_N_SP6_cDNA_D430039N05Rik, sequence:CTAGACTCGTATCATTGCTCTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11968 same embryo
 EMAGE:11965 same embryo
 EMAGE:11967 same embryo
 EMAGE:11963 same embryo
 EMAGE:11966 same embryo
 EurExpress:euxassay_008581 same experiment
 MGI:4824720 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS