Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11969

Lgi2 leucine-rich repeat LGI family, member 2 ( MGI:2180196)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11969 EMAGE:11969 EMAGE:11969 EMAGE:11969 EMAGE:11969
"Pseudo-wholemount" of euxassay_011079. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011079_01 euxassay_011079_02 euxassay_011079_03 euxassay_011079_04
EMAGE:11969 EMAGE:11969 EMAGE:11969 EMAGE:11969 EMAGE:11969
euxassay_011079_05 euxassay_011079_06 euxassay_011079_07 euxassay_011079_08 euxassay_011079_09
EMAGE:11969 EMAGE:11969 EMAGE:11969 EMAGE:11969 EMAGE:11969
euxassay_011079_10 euxassay_011079_11 euxassay_011079_12 euxassay_011079_13 euxassay_011079_14
EMAGE:11969 EMAGE:11969 EMAGE:11969 EMAGE:11969 EMAGE:11969
euxassay_011079_15 euxassay_011079_16 euxassay_011079_17 euxassay_011079_18 euxassay_011079_19
EMAGE:11969 EMAGE:11969 EMAGE:11969 EMAGE:11969 EMAGE:11969
euxassay_011079_20 euxassay_011079_21 euxassay_011079_22 euxassay_011079_23 euxassay_011079_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11969Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11969_wholemount_strong.wlz
11969_wholemount_moderate.wlz
11969_wholemount_weak.wlz
11969_wholemount_possible.wlz
11969_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11969_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
moderate moderate
regionalmoderate expression: see section 11 18 19
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 09 10 weak expression: see section 20 21
thalamus mantle layer
weak weak
regionalweak expression: see section 10 12 13 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
single cellmoderate expression: see section 11 17
pons mantle layer
moderate moderate
single cellmoderate expression: see section 12 16 17
ventral grey horn
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17
naris
moderate moderate
regionalmoderate expression: see section 14 15 17 18
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 17 18 19 20 21 moderate expression: see section 14
esophagus
strong strong
regionalstrong expression: see section 14 15
mandible
moderate moderate
regionalmoderate expression: see section 24 weak expression: see section 09 10 20 21 23
oral epithelium
strong strong
regionalstrong expression: see section 12 13 18 moderate expression: see section 14 15 16 17 19 23 weak expression: see section 06 07 08 09 10 11 20 21 22
maxilla
weak weak
regionalweak expression: see section 09 10 20 21
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 23 24 weak expression: see section 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36586
Entity Detected:Lgi2, leucine-rich repeat LGI family, member 2 ( MGI:2180196)
Sequence:sense strand is shown

>T36586
AAGATGACAAACTCCACCGTCTCTGATGTGCTGTGTATCGGTCCACCAGAATACCAGGAGAAGAAACTCA
ACGAAGTGACCAGCTTTGACTATGAGTGTACCACCACAGGTCCCCAGACTGATGAAGCCAAGCAGAGAGG
ATGGCAGTTGGAACTCTCCCTGGGATTTTGTGAACTAATATTTGTTTTTCAACACCCACTCTCAGATTTT
GTCGTTCATCAGACTCTGCCGTACCAGTCGGTGTCAGTAGACACGTTCAACTCCAAGAACGATGTGTACG
TGGCCATCGCTCAGCCCAGCATGGAGAACTGCATGGTGTTGGAGTGGGACCACATAGAAATGAATTTCCG
GAGTTATGACAATATCACAGGCCAGTCCATCGTGGGCTGCAAGGCCATCCTCATTGACGACCAGGTCTTT
GTGGTGGTGGCCCAGCTCTTCGGTGGCTCTCACATTTACAAATACGACGAGAGCTGGACCAAGTTTGTCA
AGTTCCAAGACATAGAGGTGTCTCGGATTTCCAAGCCCAACGACATTGAGCTGTTCGAGATCGACGACGA
GACCTTCTTCATCATCGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66865. Forward Primer - name:066865_F_cDNA_Lgi2, sequence:AAGATGACAAACTCCACCGTCT; Reverse Primer - name:066865_N_SP6_cDNA_Lgi2, sequence:GGCGATGATGAAGAAGGTCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11970 same embryo
 EMAGE:11974 same embryo
 EMAGE:11971 same embryo
 EMAGE:11972 same embryo
 EMAGE:11973 same embryo
 EurExpress:euxassay_011079 same experiment
 MGI:4825912 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS