Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11988

Lamb1 laminin B1 ( MGI:96743)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11988 EMAGE:11988 EMAGE:11988 EMAGE:11988 EMAGE:11988
"Pseudo-wholemount" of euxassay_011018. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011018_01 euxassay_011018_02 euxassay_011018_03 euxassay_011018_04
EMAGE:11988 EMAGE:11988 EMAGE:11988 EMAGE:11988 EMAGE:11988
euxassay_011018_05 euxassay_011018_06 euxassay_011018_07 euxassay_011018_08 euxassay_011018_09
EMAGE:11988 EMAGE:11988 EMAGE:11988 EMAGE:11988 EMAGE:11988
euxassay_011018_10 euxassay_011018_11 euxassay_011018_12 euxassay_011018_13 euxassay_011018_14
EMAGE:11988 EMAGE:11988 EMAGE:11988 EMAGE:11988 EMAGE:11988
euxassay_011018_15 euxassay_011018_16 euxassay_011018_17 euxassay_011018_18 euxassay_011018_19
EMAGE:11988 EMAGE:11988 EMAGE:11988 EMAGE:11988 EMAGE:11988
euxassay_011018_20 euxassay_011018_21 euxassay_011018_22 euxassay_011018_23 euxassay_011018_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11988Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11988_wholemount_strong.wlz
11988_wholemount_moderate.wlz
11988_wholemount_weak.wlz
11988_wholemount_possible.wlz
11988_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11988_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 09 10 11 16 19
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 08 09 19 20
vibrissa
weak weak
regionalweak expression: see section 06 07 08 09 22 23 24
diencephalon meninges
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon meninges
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hindbrain meninges
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
spinal cord meninges
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16
cochlea
moderate moderate
regionalmoderate expression: see section 04 05 weak expression: see section 06 07 09 10 17 18 19 20 21
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 24 weak expression: see section 23
midgut
weak weak
regionalweak expression: see section 07 08 09 11 12 13 14 15 16 17 18 19 20
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17
lower jaw molar
weak weak
regionalweak expression: see section 20
upper jaw incisor
weak weak
regionalweak expression: see section 13 17 18
upper jaw molar
weak weak
regionalweak expression: see section 21
urinary system
moderate moderate
regionalmoderate expression: see section 05 22
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 17 18 19 20
lung
moderate moderate
regionalmoderate expression: see section 05 06 07 11 12 19 weak expression: see section 03 04 08 09 10 13 14 15 16 17 18 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36579
Entity Detected:Lamb1, laminin B1 ( MGI:96743)
Sequence:sense strand is shown

>T36579
TCGAGGAGGCAGAGAAACTAACCAAAGATGTCACAGAAAAGATGGCGCAGGTAGAAGTGAAATTAACTGA
TACAGCTTCACAGAGTAACAGCACAGCTGGAGAGCTCGGCGCACTGCAGGCAGAAGCAGAGAGCCTTGAC
AAGACCGTGAAGGAGCTGGCAGAACAGCTGGAGTTTATCAAAAACTCCGATATTCAGGGCGCCTTGGATA
GCATCACCAAGTATTTCCAGATGTCTCTTGAGGCAGAGAAGCGGGTGAATGCCTCCACCACAGACCCCAA
CAGCACTGTGGAGCAGTCTGCCCTCACGCGAGACAGAGTAGAAGATCTGATGTTGGAGCGAGAGTCTCCG
TTCAAGGAGCAGCAGGAGGAACAGGCACGCCTCCTGGACGAACTGGCCGGCAAACTGCAAAGTCTCGACC
TGTCGGCTGCTGCACAGATGACCTGTGGAACACCTCCAGGGGCTGACTGTTCTGAAAGTGAATGTGGTGG
CCCCAACTGCAGAACTGACGAAGGAGAGAAGAAGTGTGGGGGGCCTGGCTGTGGTGGTCTGGTCACTGTG
GCCCACAGTGCTTGGCAGAAAGCCATGGATTTTGACCGTGATGTCCTGAGTGCCCTGGCTGAAGTCGAAC
AGCTCTCCAAGATG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100799. Forward Primer - name:100799_F_cDNA_Lamb1-1, sequence:TCGAGGAGGCAGAGAAACTAAC; Reverse Primer - name:100799_N_SP6_cDNA_Lamb1-1, sequence:CATCTTGGAGAGCTGTTCGAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11992 same embryo
 EMAGE:11991 same embryo
 EMAGE:11990 same embryo
 EMAGE:11993 same embryo
 EMAGE:11989 same embryo
 EurExpress:euxassay_011018 same experiment
 MGI:4825861 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS