Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12001

Kcnj10 potassium inwardly-rectifying channel, subfamily J, member 10 ( MGI:1194504)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12001 EMAGE:12001 EMAGE:12001 EMAGE:12001 EMAGE:12001
"Pseudo-wholemount" of euxassay_011023. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011023_01 euxassay_011023_02 euxassay_011023_03 euxassay_011023_04
EMAGE:12001 EMAGE:12001 EMAGE:12001 EMAGE:12001 EMAGE:12001
euxassay_011023_05 euxassay_011023_06 euxassay_011023_07 euxassay_011023_08 euxassay_011023_09
EMAGE:12001 EMAGE:12001 EMAGE:12001 EMAGE:12001 EMAGE:12001
euxassay_011023_10 euxassay_011023_11 euxassay_011023_12 euxassay_011023_13 euxassay_011023_14
EMAGE:12001 EMAGE:12001 EMAGE:12001 EMAGE:12001 EMAGE:12001
euxassay_011023_15 euxassay_011023_16 euxassay_011023_17 euxassay_011023_18 euxassay_011023_19
EMAGE:12001 EMAGE:12001 EMAGE:12001 EMAGE:12001 EMAGE:12001
euxassay_011023_20 euxassay_011023_21 euxassay_011023_22 euxassay_011023_23 euxassay_011023_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12001Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12001_wholemount_strong.wlz
12001_wholemount_moderate.wlz
12001_wholemount_weak.wlz
12001_wholemount_possible.wlz
12001_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12001_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 11 12
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 11 12 13
medulla oblongata basal plate ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16
pons ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 13 14 15 16 17 18
midbrain ventricular layer
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15
spinal cord ventricular layer
weak weak
regionalweak expression: see section 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36541
Entity Detected:Kcnj10, potassium inwardly-rectifying channel, subfamily J, member 10 ( MGI:1194504)
Sequence:sense strand is shown

>T36541
TCCTACCCCTGACTTTCTACCACGTGGTAGATGAGACCAGCCCCTTAAAAGATCTCCCGCTCCGCAGTGG
GGAGGGGGACTTTGAGCTGGTGCTGATCCTGAGTGGGACAGTGGAGTCCACCAGTGCCACCTGCCAAGTT
CGCACTTCCTACCTACCGGAGGAGATCCTCTGGGGTTACGAGTTCACGCCTGCGATCTCACTGTCAGCCA
GTGGCAAATACATAGCTGACTTCAGCCTTTTCGACCAGGTTGTGAAAGTGGCATCTCCCAGTGGTCTCCG
CGATAGCACCGTACGCTATGGAGACCCCGAGAAGCTCAAGTTGGAGGAGTCATTAAGAGAGCAAGCTGAA
AAGGAAGGCAGTGCCCTTAGTGTGCGCATCAGCAACGTCTGATATCCTGTTCTCTCCTCCCCAGCCCTCT
GGCCTTTTCCTCTTCCAGTGCTCTGGGAAAAGGATACAATCTGGGTTCGCTGGAGAGACCCTGAAGCACC
CACCCTCAACTTCCCCTTAGCCCGGTGGCCTGTGAGCAGTCGGGGCCTGCTGGAGCCCTTCCTTTTCCTC
TCACTGTCCCCTTGTACCTTCCTCTACCACTACACCAATGTATATGACTCTTAAGCCAGCTTGGGGGAAA
GAGAGGGAAGATGAGGCTGACATGGCTTGGAAGGCCGCAGCCATGCTTGGAGATTCACATTCAGAGGACC
ATGTGACTGGATGGATAGACTCCCCCCCAAACGCCCACCACTAGAAAATTTGATGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 95999. Forward Primer - name:095999_F_cDNA_Kcnj10, sequence:TCCTACCCCTGACTTTCTACCA; Reverse Primer - name:095999_N_SP6_cDNA_Kcnj10, sequence:GCCATCAAATTTTCTAGTGGTGG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12003 same embryo
 EMAGE:12000 same embryo
 EMAGE:12004 same embryo
 EMAGE:11999 same embryo
 EMAGE:12002 same embryo
 EurExpress:euxassay_011023 same experiment
 MGI:4825714 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS