Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12002

Kera keratocan ( MGI:1202398)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12002 EMAGE:12002 EMAGE:12002 EMAGE:12002 EMAGE:12002
"Pseudo-wholemount" of euxassay_011025. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011025_01 euxassay_011025_02 euxassay_011025_03 euxassay_011025_04
EMAGE:12002 EMAGE:12002 EMAGE:12002 EMAGE:12002 EMAGE:12002
euxassay_011025_05 euxassay_011025_06 euxassay_011025_07 euxassay_011025_08 euxassay_011025_09
EMAGE:12002 EMAGE:12002 EMAGE:12002 EMAGE:12002 EMAGE:12002
euxassay_011025_10 euxassay_011025_11 euxassay_011025_12 euxassay_011025_13 euxassay_011025_14
EMAGE:12002 EMAGE:12002 EMAGE:12002 EMAGE:12002 EMAGE:12002
euxassay_011025_15 euxassay_011025_16 euxassay_011025_17 euxassay_011025_18 euxassay_011025_19
EMAGE:12002 EMAGE:12002 EMAGE:12002 EMAGE:12002
euxassay_011025_20 euxassay_011025_21 euxassay_011025_22 euxassay_011025_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12002Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12002_wholemount_strong.wlz
12002_wholemount_moderate.wlz
12002_wholemount_weak.wlz
12002_wholemount_possible.wlz
12002_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12002_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hand mesenchyme
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 23
foot mesenchyme
strong strong
regionalstrong expression: see section 01 02 22 moderate expression: see section 04 23
cranial muscle
strong strong
regionalstrong expression: see section 05 21 22 moderate expression: see section 04 weak expression: see section 02 03 23
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 08 10 16 17
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 14 15
extrinsic ocular muscle
strong strong
regionalstrong expression: see section 01 moderate expression: see section 02 weak expression: see section 03 22
nasal septum
strong strong
regionalstrong expression: see section 13 15
lower lip
strong strong
regionalstrong expression: see section 07 20 weak expression: see section 06
upper lip
strong strong
regionalstrong expression: see section 06 20 weak expression: see section 07
palatal shelf
moderate moderate
regionalmoderate expression: see section 09 10 14 15 weak expression: see section 11
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36545
Entity Detected:Kera, keratocan ( MGI:1202398)
Sequence:sense strand is shown

>T36545
CCTCTACCTGGAAAACAACCTGATTGAATCCATACCAGAGAAGCCCTTTGAGAATGCCACCCAGCTGAGA
TGGATCAATTTAAACAAGAACAAAATAACCAACTACGGGATTGAGAAGGGGGCCCTGAGCCAGCTAAAGA
AACTTCTTTTCCTGTTTCTTGAAGACAATGAGCTAGAGGAGGTACCTTCTCCATTGCCAAGAAGTTTGGA
ACAATTACAATTAGCTAGAAACAAAGTATCCAGAATCCCTCAGGGGACCTTCAGTAATCTGGAAAACCTG
ACCCTTCTTGATCTGCAGCATAACAAACTATTAGACAACGCCTTTCAAAGAGATACTTTCAAGGGCCTTA
AGAACCTCATGCAGTTAAATATGGCGAAGAATGCCCTGAGGAACATGCCCCCAAGATTACCAGCCAACAC
CATGCAACTCTTTCTAGACAACAACTCCATTGAAGGAATACCTGAAAATTATTTCAATGTGATTCCTAAG
GTGGCTTTCCTGAGGCTCAACCACAACAAACTATCAGATGCAGGTCTCCCGTCGAGGGGTTTTGATGTGT
CATCCATTCTGGATCTTCAACTGTCTTACAACCAGCTCACAAACTTTCCCCGAATCAATGCTAACCTGCA
GCACCTTCACCTTGATCACAACAAAATTAAAAATGTGAACATGTCTGTAATATGTCCCACCACACTGCGT
GCAGAACAGGATGCCTTCATTCACGGACCACAACTGAGCTACCTGCGTCTGGATGGGAATGAAATCAAGC
CACCGATC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98004. Forward Primer - name:098004_F_cDNA_Kera, sequence:CCTCTACCTGGAAAACAACCTG; Reverse Primer - name:098004_N_SP6_cDNA_Kera, sequence:GATCGGTGGCTTGATTTCATT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12003 same embryo
 EMAGE:12000 same embryo
 EMAGE:12004 same embryo
 EMAGE:12001 same embryo
 EMAGE:11999 same embryo
 EurExpress:euxassay_011025 same experiment
 MGI:4825748 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS