Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12007

Cotl1 coactosin-like 1 (Dictyostelium) ( MGI:1919292)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12007 EMAGE:12007 EMAGE:12007 EMAGE:12007 EMAGE:12007
"Pseudo-wholemount" of euxassay_010951. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010951_01 euxassay_010951_02 euxassay_010951_03 euxassay_010951_04
EMAGE:12007 EMAGE:12007 EMAGE:12007 EMAGE:12007 EMAGE:12007
euxassay_010951_05 euxassay_010951_06 euxassay_010951_07 euxassay_010951_08 euxassay_010951_09
EMAGE:12007 EMAGE:12007 EMAGE:12007 EMAGE:12007 EMAGE:12007
euxassay_010951_10 euxassay_010951_11 euxassay_010951_12 euxassay_010951_13 euxassay_010951_14
EMAGE:12007 EMAGE:12007 EMAGE:12007 EMAGE:12007 EMAGE:12007
euxassay_010951_15 euxassay_010951_16 euxassay_010951_17 euxassay_010951_18 euxassay_010951_19
EMAGE:12007 EMAGE:12007 EMAGE:12007 EMAGE:12007 EMAGE:12007
euxassay_010951_20 euxassay_010951_21 euxassay_010951_22 euxassay_010951_23 euxassay_010951_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12007Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12007_wholemount_strong.wlz
12007_wholemount_moderate.wlz
12007_wholemount_weak.wlz
12007_wholemount_possible.wlz
12007_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12007_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
thalamus mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
thalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 07 11 17
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 08 09 10 15 16 17
lens
strong strong
regionalstrong expression: see section 01
neural retina
strong strong
regionalstrong expression: see section 01 02 03 23 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
vomeronasal organ epithelium
strong strong
regionalstrong expression: see section 11 14
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 12 13
pharynx epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13
stomach
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09
midgut
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
renal cortex
strong strong
regionalstrong expression: see section 07 08 09 10 17 18 19 20
trachea
moderate moderate
regionalmoderate expression: see section 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36187
Entity Detected:Cotl1, coactosin-like 1 (Dictyostelium) ( MGI:1919292)
Sequence:sense strand is shown

>T36187
CAGATTACCAGCACTTCATCCAGCAGTGCACAGATGATGTCCGGCTGTTCGCCTTTGTGCGCTTCACCAC
CGGCGACGCCATGAGCAAAAGATCCAAGTTTGCCCTCATCACATGGATCGGGGAGGACGTGAGTGGACTG
CAGCGTGCCAAGACGGGGACCGACAAGACGCTGGTGAAGGAGGTGGTCCAGAATTTTGCAAAGGAATTTG
TGATCAGCGACCGGAAGGAGCTAGAGGAAGACTTCATCAGGAGCGAGCTGAAGAAGGCTGGGGGGGCCAA
CTACGACGCTCAGTCAGAGTAGCTACAGCCCCACAGCCCAGAGCCATCTGCCTGCTCCGCCAAGGAGGAG
ACTGCCGCCTCACGTCACCAGCCCACCAGGGAGGAGAAGCCATGAGAGGCACCAGCGCCACCAGTGTGTC
CAACCCTCCCCTTCCCTCTCCCCCCTGTGGCCCCTCTCAAGCTCACCAAGCATCATTCTTTGAGACCCGC
CCCCCCTTTTGTTTTAAAGAAGTCATTTTGGTGCCAGGGTCATGCATACCATCTGATCCCAGAAGCCTCT
CTGTCACTGGCCCTGGACCTGGCATTTACCCCTGCCGTCACCGTGGCCTGCCTGGTCTAAGCTACCCTGG
CCTTGAGTTGCTGAGGCCTGGTCAGGTGCCACCCCAGCTTGACCTGGCTGTTTCCTGCTAGCCCTACGCC
GGCCACCAATACCAGGAGCTGTGCACACCTTACAGCCTTCATGAGCTCCCATGCGCGCGCATGCTCCTCA
GAGCCCATAGTTGTGGCCCCAGGCCTCACCCCTGTCCTGTTCAGAGTGGCCTTGAGCTGTCCCTCTGGTA
GACAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 91451. Forward Primer - name:091451_F_cDNA_Cotl1, sequence:CAGATTACCAGCACTTCATCCA; Reverse Primer - name:091451_N_SP6_cDNA_Cotl1, sequence:GTGTCTACCAGAGGGACAGCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12010 same embryo
 EMAGE:12006 same embryo
 EMAGE:12009 same embryo
 EMAGE:12005 same embryo
 EMAGE:12008 same embryo
 EurExpress:euxassay_010951 same experiment
 MGI:4824014 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS