Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12030

Gpr50 G-protein-coupled receptor 50 ( MGI:1333877)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12030 EMAGE:12030 EMAGE:12030 EMAGE:12030 EMAGE:12030
"Pseudo-wholemount" of euxassay_008378. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008378_01 euxassay_008378_02 euxassay_008378_03 euxassay_008378_04
EMAGE:12030 EMAGE:12030 EMAGE:12030 EMAGE:12030 EMAGE:12030
euxassay_008378_05 euxassay_008378_06 euxassay_008378_07 euxassay_008378_08 euxassay_008378_09
EMAGE:12030 EMAGE:12030 EMAGE:12030 EMAGE:12030 EMAGE:12030
euxassay_008378_10 euxassay_008378_11 euxassay_008378_12 euxassay_008378_13 euxassay_008378_14
EMAGE:12030 EMAGE:12030 EMAGE:12030 EMAGE:12030 EMAGE:12030
euxassay_008378_15 euxassay_008378_16 euxassay_008378_17 euxassay_008378_18 euxassay_008378_19
EMAGE:12030 EMAGE:12030 EMAGE:12030 EMAGE:12030 EMAGE:12030
euxassay_008378_20 euxassay_008378_21 euxassay_008378_22 euxassay_008378_23 euxassay_008378_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12030Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12030_wholemount_strong.wlz
12030_wholemount_moderate.wlz
12030_wholemount_weak.wlz
12030_wholemount_possible.wlz
12030_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12030_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
strong strong
single cellstrong expression: see section 11 12 14 15
hypothalamus ventricular layer
strong strong
single cellstrong expression: see section 13 weak expression: see section 14
diencephalon lateral wall mantle layer
strong strong
single cellstrong expression: see section 11
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 11 13 14
pons mantle layer
strong strong
single cellstrong expression: see section 05 06 07 08 17 18 19 moderate expression: see section 04 20
tubotympanic recess
moderate moderate
regionalmoderate expression: see section 05 06 07 08 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35213
Entity Detected:Gpr50, G-protein-coupled receptor 50 ( MGI:1333877)
Sequence:sense strand is shown

>T35213
CCGAAGAGAATACTGGACCATCTTCCATGCTATGCGGCACCCTATCCTGTTCATCTCTCACCTCATCAGT
GATATTCGGGAGACTTGGGAGACCCGAGCTCTCACTCGTGCCCGTGTCCGTGCCCGTGATCAAGTCCGAG
AGCAAGAGCGTGCTCGTGCCTGTGTCGCTGTGGAGGGGACCCCAAGGAACGTCCGGAATGTTCTACTGCC
TGGTGATGCATCAGCACCCCACTCTGATCGTGCCTCTGTCCGTCCCAAGCCCCAAACCAGGTCTACTTCT
GTCTACCGCAAACCTGCCTCTATCCACCACAAGTCTATTTCTGGCCACCCCAAGTCTGCCTCTGTTTACC
CTAAGCCAGCCTCCTCTGTCCATTGCAAGCCTGCCTCTGTCCATTTCAAACCCGCCTCTGTTCATTTCAA
GGGTGACTCTGTCTATTTCAAGGGAGACACTGTCCATTACAGGGCTGCTTCCAAACTTGTCACCAGTCAC
CGTATCTCTGCTGGCCCTTCCACCAGTCACCCTACATCCATGGCTGGCTACATTAAATCTGGTAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 74332. Forward Primer - name:074332_F_cDNA_Gpr50, sequence:CCGAAGAGAATACTGGACCATC; Reverse Primer - name:074332_N_SP6_cDNA_Gpr50, sequence:GTACCAGATTTAATGTAGCCAGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12029 same embryo
 EMAGE:12032 same embryo
 EMAGE:12028 same embryo
 EMAGE:12031 same embryo
 EurExpress:euxassay_008378 same experiment
 MGI:4825189 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS