Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12117

Klhl13 kelch-like 13 (Drosophila) ( MGI:1914705)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12117 EMAGE:12117 EMAGE:12117 EMAGE:12117 EMAGE:12117
"Pseudo-wholemount" of euxassay_010975. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_010975_01 euxassay_010975_02 euxassay_010975_03 euxassay_010975_04
EMAGE:12117 EMAGE:12117 EMAGE:12117 EMAGE:12117 EMAGE:12117
euxassay_010975_05 euxassay_010975_06 euxassay_010975_07 euxassay_010975_08 euxassay_010975_09
EMAGE:12117 EMAGE:12117 EMAGE:12117 EMAGE:12117 EMAGE:12117
euxassay_010975_10 euxassay_010975_11 euxassay_010975_12 euxassay_010975_13 euxassay_010975_14
EMAGE:12117 EMAGE:12117 EMAGE:12117 EMAGE:12117 EMAGE:12117
euxassay_010975_15 euxassay_010975_16 euxassay_010975_17 euxassay_010975_18 euxassay_010975_19
EMAGE:12117 EMAGE:12117 EMAGE:12117 EMAGE:12117 EMAGE:12117
euxassay_010975_20 euxassay_010975_21 euxassay_010975_22 euxassay_010975_23 euxassay_010975_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12117Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12117_wholemount_strong.wlz
12117_wholemount_moderate.wlz
12117_wholemount_weak.wlz
12117_wholemount_possible.wlz
12117_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12117_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 24
upper leg muscle
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 22 23 24
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03
hand
moderate moderate
regionalmoderate expression: see section 02 03
foot
moderate moderate
regionalmoderate expression: see section 07 08 09 22 23 24
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 14 17
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 05 11 15 16 17 19 21 22 weak expression: see section 07 08 10 18 20
pons mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 15 16 17 19 21 22 weak expression: see section 07 08 18 20
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
spinal cord mantle layer
weak weak
regionalweak expression: see section 11 12 13 14 15 16 17 18
tongue muscle
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 weak expression: see section 20 21
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36557
Entity Detected:Klhl13, kelch-like 13 (Drosophila) ( MGI:1914705)
Sequence:sense strand is shown

>T36557
CCCTCTTTCTGGACCCTAAGATCATCCTTACAATTAAGATGCTATATTCCTATCTTTGCAATGTGTCATG
ATTATCTTCTTTTCCCCCCTTAAGTAGCATATATGTTAGAGTTAGCCTTCAGTAATTGATACAGAAAAAA
AATTGACATTGATGTTACTTGTGATGTTTGTATGGCCTAGAATGTTTATAAAGTGGTAACAAACCATCCT
TGAAATATATCCCATAGAAGCTGATGTTTAACATGAAAACAAAAAAAGTATTGTCTACAAAGTGTTTCTT
CAGTACTTTCTAAATGCTGTGTACTGAGTGTAAGGGATTCCTCATCTTACATTATAAGCCAAGTTGAAGG
TGGATTATAGTAAATGTACAACTGTGCTCACTAGGTTTCAAAGTGAAGAAGTTTTCCTTTCATCTTTAAC
TGTAAGATGTCAAAGGGAGGCAGCCTGCTCCAATAGGAAACAGTACACAAAAGGTTGCCAACTCGCATGA
GCTACCTCCCTCTTTTCATAAAGTATTTTTGACACATCTGTCAACCCACCTGACTGTGTGGGTGCATTGA
GAACACACCAAGTTTCTAAGACACACAGGAGAAATAACTGAAATTCACCAACACTAGTTTGTGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100809. Forward Primer - name:100809_F_cDNA_Klhl13, sequence:CCCTCTTTCTGGACCCTAAGAT; Reverse Primer - name:100809_N_SP6_cDNA_Klhl13, sequence:CCCACAAACTAGTGTTGGTGAAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12120 same embryo
 EMAGE:12115 same embryo
 EMAGE:12119 same embryo
 EMAGE:12116 same embryo
 EMAGE:12118 same embryo
 EurExpress:euxassay_010975 same experiment
 MGI:4825793 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS