Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12228

Htr3a 5-hydroxytryptamine (serotonin) receptor 3A ( MGI:96282)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12228 EMAGE:12228 EMAGE:12228 EMAGE:12228 EMAGE:12228
"Pseudo-wholemount" of euxassay_008385. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008385_01 euxassay_008385_02 euxassay_008385_03 euxassay_008385_04
EMAGE:12228 EMAGE:12228 EMAGE:12228 EMAGE:12228 EMAGE:12228
euxassay_008385_05 euxassay_008385_06 euxassay_008385_07 euxassay_008385_08 euxassay_008385_09
EMAGE:12228 EMAGE:12228 EMAGE:12228 EMAGE:12228 EMAGE:12228
euxassay_008385_10 euxassay_008385_11 euxassay_008385_12 euxassay_008385_13 euxassay_008385_14
EMAGE:12228 EMAGE:12228 EMAGE:12228 EMAGE:12228 EMAGE:12228
euxassay_008385_15 euxassay_008385_16 euxassay_008385_17 euxassay_008385_18 euxassay_008385_19
EMAGE:12228 EMAGE:12228 EMAGE:12228 EMAGE:12228 EMAGE:12228
euxassay_008385_20 euxassay_008385_21 euxassay_008385_22 euxassay_008385_23 euxassay_008385_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12228Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12228_wholemount_strong.wlz
12228_wholemount_moderate.wlz
12228_wholemount_weak.wlz
12228_wholemount_possible.wlz
12228_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12228_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
glossopharyngeal ix ganglion
strong strong
single cellstrong expression: see section 07 08 17 18
trigeminal v ganglion
strong strong
single cellstrong expression: see section 18 19 20 21 moderate expression: see section 03 04 05 06 07 08 09 22
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 09 17 18 weak expression: see section 10 11 12
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35238
Entity Detected:Htr3a, 5-hydroxytryptamine (serotonin) receptor 3A ( MGI:96282)
Sequence:sense strand is shown

>T35238
GCCTTGACATCTACAACTTCCCCTTTGATGTGCAGAACTGTTCTCTGACTTTCACCAGCTGGCTGCACAC
CATCCAGGACATCAACATTACTCTGTGGCGATCACCGGAAGAAGTGAGGTCTGACAAGAGCATCTTCATA
AATCAGGGCGAGTGGGAGCTGCTGGAGGTGTTCCCCCAGTTCAAGGAGTTCAGCATAGATATCAGTAACA
GCTATGCAGAAATGAAGTTCTACGTGATCATCCGCCGGAGGCCTTTATTCTATGCAGTCAGCCTCTTGCT
GCCCAGTATCTTCCTCATGGTCGTGGACATTGTGGGCTTTTGCCTGCCCCCGGACAGTGGTGAGAGAGTC
TCTTTCAAGATCACACTCCTTCTGGGATACTCAGTCTTCCTCATCATCGTGTCAGACACACTGCCGGCAA
CGATCGGTACCCCCCTCATTGGTGTCTACTTTGTGGTGTGCATGGCTCTGCTAGTGATAAGCCTCGCTGA
GACCATCTTCATTGTGCGGCTGGTGCATAAGCAGGACCTACAGCGGCCAGTACCTGACTGGCTGAGGCAC
CTGGTCCTAGACAGAATAGCCTGGATACTCTGCCTAGGGGAGCAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99794. Forward Primer - name:099794_F_cDNA_Htr3a, sequence:GCCTTGACATCTACAACTTCCC; Reverse Primer - name:099794_N_SP6_cDNA_Htr3a, sequence:CTGCTCCCCTAGGCAGAGTATC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12229 same embryo
 EurExpress:euxassay_008385 same experiment
 MGI:4825484 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS