Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12242

Lpar4 lysophosphatidic acid receptor 4 ( MGI:1925384)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12242 EMAGE:12242 EMAGE:12242 EMAGE:12242 EMAGE:12242
"Pseudo-wholemount" of euxassay_008259. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008259_01 euxassay_008259_02 euxassay_008259_03 euxassay_008259_04
EMAGE:12242 EMAGE:12242 EMAGE:12242 EMAGE:12242 EMAGE:12242
euxassay_008259_05 euxassay_008259_06 euxassay_008259_07 euxassay_008259_08 euxassay_008259_09
EMAGE:12242 EMAGE:12242 EMAGE:12242 EMAGE:12242 EMAGE:12242
euxassay_008259_10 euxassay_008259_11 euxassay_008259_12 euxassay_008259_13 euxassay_008259_14
EMAGE:12242 EMAGE:12242 EMAGE:12242 EMAGE:12242 EMAGE:12242
euxassay_008259_15 euxassay_008259_16 euxassay_008259_17 euxassay_008259_18 euxassay_008259_19
EMAGE:12242 EMAGE:12242 EMAGE:12242 EMAGE:12242 EMAGE:12242
euxassay_008259_20 euxassay_008259_21 euxassay_008259_22 euxassay_008259_23 euxassay_008259_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12242Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12242_wholemount_strong.wlz
12242_wholemount_moderate.wlz
12242_wholemount_weak.wlz
12242_wholemount_possible.wlz
12242_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12242_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
moderate moderate
regionalmoderate expression: see section 01 02 04 21 22 23 weak expression: see section 24
upper leg muscle
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 19 20 21 22 23 24
rib
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 16 17 18 19 20 21 22 23 24
diaphragm
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
forearm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01
humerus
moderate moderate
regionalmoderate expression: see section 04 21 22 23
upper arm rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 03
hand
moderate moderate
regionalmoderate expression: see section 01 02 03 04 23 24
foot
moderate moderate
regionalmoderate expression: see section 03 05 06 07 23 24
hindlimb digit 2 metatarsal
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 3 metatarsal
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 4 metatarsal
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 5 metatarsal
moderate moderate
regionalmoderate expression: see section 04
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 04
knee
moderate moderate
regionalmoderate expression: see section 01
fibula
moderate moderate
regionalmoderate expression: see section 02
tibia
moderate moderate
regionalmoderate expression: see section 02
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 03 04 05 22
femur
moderate moderate
regionalmoderate expression: see section 07 19 20 21 22
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
otic capsule
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 16 17 18 19 20
naris
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18
nasal septum
moderate moderate
regionalmoderate expression: see section 14 15 16
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
heart ventricle
moderate moderate
spottedmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
tongue
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
stomach
moderate moderate
spottedmoderate expression: see section 05 06 07 08 09 10 11
midgut
moderate moderate
spottedmoderate expression: see section 11 12 13 14 15 16 17 18 19 20
thyroid cartilage
moderate moderate
regionalmoderate expression: see section 13
axial skeleton
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 13 14 15 16
clavicle
strong strong
regionalstrong expression: see section 10 17
sternum
strong strong
regionalstrong expression: see section 14 15 moderate expression: see section 13
tail paraxial mesenchyme
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35201
Entity Detected:Lpar4, lysophosphatidic acid receptor 4 ( MGI:1925384)
Sequence:sense strand is shown

>T35201
CATCAGTGTGGATCGTTTCCTAGCCATTGTCTATCCCTTCCGATCGCGTACCATCAGGACCAGGAGGAAT
TCCGCCATTGTGTGCGCTGGAGTCTGGATCCTAGTCCTCAGTGGTGGTATTTCAGCTTCTTTGTTCTCCA
CCACTAATGTCAACAATGCGACCACCACTTGCTTTGAAGGCTTCTCCAAACGTGTCTGGAAGACATACCT
GTCCAAGATCACTATATTCATTGAAGTTGTTGGATTCATCATTCCTCTGATATTGAATGTTTCTTGTTCT
TCTGTGGTGCTTAGAACCCTCCGCAAGCCTGCAACATTGTCTCAGATTGGGACCAATAAAAAAAAAGTGT
TGAAGATGATCACAGTGCATATGGCAGTGTTTGTGGTATGCTTTGTACCATACAACTCCGTTCTCTTTTT
ATATGCCTTGGTACGCTCCCAAGCCATTACTAATTGCTTATTGGAAAGGTTTGCAAAGATCATGTACCCA
ATTACCTTGTGCCTTGCAACTCTGAATTGTTGCTTTGATCCTTTTATCTATTACTTCACTCTTGAATCCT
TTCAGAAGTCCTTTTATATCAATACACATATAAGGATGGAGTCGCTGTTTAAGACTGAGACACCTCTGAC
CCCCAAACCTTCCCTTCCAGCTATCCAAGAGGAAGTTAGTGATCAAACAACAAATAATGGTGGTGAATTA
ATGCTGGAATCCACCTTCTAGGTACCAGAATTGTCTTTCAGGTTCAGCTACAGTGTCTCTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 68417. Forward Primer - name:068417_F_cDNA_Gpr23, sequence:CATCAGTGTGGATCGTTTCCTA; Reverse Primer - name:068417_N_SP6_cDNA_Gpr23, sequence:AAGAGACACTGTAGCTGAACCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12244 same embryo
 EMAGE:12241 same embryo
 EMAGE:12245 same embryo
 EMAGE:12243 same embryo
 EurExpress:euxassay_008259 same experiment
 MGI:4825967 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS