Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12243

Gpr26 G protein-coupled receptor 26 ( MGI:2441758)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12243 EMAGE:12243 EMAGE:12243 EMAGE:12243 EMAGE:12243
"Pseudo-wholemount" of euxassay_008318. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008318_01 euxassay_008318_02 euxassay_008318_03 euxassay_008318_04
EMAGE:12243 EMAGE:12243 EMAGE:12243 EMAGE:12243 EMAGE:12243
euxassay_008318_05 euxassay_008318_06 euxassay_008318_07 euxassay_008318_08 euxassay_008318_09
EMAGE:12243 EMAGE:12243 EMAGE:12243 EMAGE:12243 EMAGE:12243
euxassay_008318_10 euxassay_008318_11 euxassay_008318_12 euxassay_008318_13 euxassay_008318_14
EMAGE:12243 EMAGE:12243 EMAGE:12243 EMAGE:12243 EMAGE:12243
euxassay_008318_15 euxassay_008318_16 euxassay_008318_17 euxassay_008318_18 euxassay_008318_19
EMAGE:12243 EMAGE:12243 EMAGE:12243 EMAGE:12243
euxassay_008318_20 euxassay_008318_21 euxassay_008318_22 euxassay_008318_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12243Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12243_wholemount_strong.wlz
12243_wholemount_moderate.wlz
12243_wholemount_weak.wlz
12243_wholemount_possible.wlz
12243_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12243_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 13 14 15
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 04 09 22 23 weak expression: see section 05 06 07 08 17 18 19 20 21
telencephalon marginal layer
strong strong
regionalstrong expression: see section 03 weak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
olfactory cortex marginal layer
weak weak
regionalweak expression: see section 10 11 12 15 16 17 18
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 04 05 06 07 08 14 15 16 17 18 19 20 21
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 05 06 16 17 weak expression: see section 07
dorsal grey horn
moderate moderate
regionalmoderate expression: see section 08 09 10 12 13 14 15 weak expression: see section 07
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35203
Entity Detected:Gpr26, G protein-coupled receptor 26 ( MGI:2441758)
Sequence:sense strand is shown

>T35203
CTTCTGACCCCTTCGTGTATTCCTTGCTGCGACACCAATACCGCAGGAGCTGCAAGGAGCTCCTGAACAG
GATCTTCAACAGACGCTCCCTTCACTCTGTGGGCCTCACAGGTGACTCTCACAGCCAGAACATTCTGCCA
GTGTCGGAATGAAGGACCACTCTCCTGATGGGGAGTTCAGAACGAGGTGGCCAGAGCAAAGGGAGGTGGT
CTGGGACTCCTGGGTGGACAATAACTGCCACCATTGCCTGGTGATTGCCGTGATGCTGACGTCTGAACAA
GATCTGGGGCCTGCTTCTTGGCTCTTCCAGGGTAGATGTCAGACTGTCCCTATTTGTCGCCAAAGGATGG
CCATAGGCCACGCCCTGGCCTTTCTTTCTGAGAGTGTGTATTGAGAGCTTAGACTCACCAAAGGCCTCTC
AGAGGACGGTAGGCCAGTTAGTGTCAAAGACACAGAGTGCTGGTGGCAGGTGTGGGCATGATATCCACCT
GTCTACTAACTACTGCTCATGGGGCTCCATGCTCCAAGGGACATCTTAGTGATGCTGAAAGTGAGGTTGT
CTGTGGCCATCTGGCTCCAGATCTACTATGGCATCTCTTTTCCCCTTGGTAGTGTTTGCTGCTGTAACCC
AAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 67927. Forward Primer - name:067927_F_cDNA_Gpr26, sequence:CTTCTGACCCCTTCGTGTATTC; Reverse Primer - name:067927_N_SP6_cDNA_Gpr26, sequence:TTTGGGTTACAGCAGCAAACA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12244 same embryo
 EMAGE:12242 same embryo
 EMAGE:12241 same embryo
 EMAGE:12245 same embryo
 EurExpress:euxassay_008318 same experiment
 MGI:4825186 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS