Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12278

Jag2 jagged 2 ( MGI:1098270)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12278 EMAGE:12278 EMAGE:12278 EMAGE:12278 EMAGE:12278
"Pseudo-wholemount" of euxassay_011055. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011055_01 euxassay_011055_02 euxassay_011055_03 euxassay_011055_04
EMAGE:12278 EMAGE:12278 EMAGE:12278 EMAGE:12278 EMAGE:12278
euxassay_011055_05 euxassay_011055_06 euxassay_011055_07 euxassay_011055_08 euxassay_011055_09
EMAGE:12278 EMAGE:12278 EMAGE:12278 EMAGE:12278 EMAGE:12278
euxassay_011055_10 euxassay_011055_11 euxassay_011055_12 euxassay_011055_13 euxassay_011055_14
EMAGE:12278 EMAGE:12278 EMAGE:12278 EMAGE:12278 EMAGE:12278
euxassay_011055_15 euxassay_011055_16 euxassay_011055_17 euxassay_011055_18 euxassay_011055_19
EMAGE:12278 EMAGE:12278 EMAGE:12278 EMAGE:12278
euxassay_011055_20 euxassay_011055_21 euxassay_011055_22 euxassay_011055_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12278Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12278_wholemount_strong.wlz
12278_wholemount_moderate.wlz
12278_wholemount_weak.wlz
12278_wholemount_possible.wlz
12278_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12278_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 19 20 21 22 23
thymus primordium
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 11 12 13 14
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 16 17 18 19 20
vibrissa
weak weak
regionalweak expression: see section 04 05 06 07 08 21 22 23
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05 06 07 17 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22
dorsal root ganglion
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 16 17 18
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 04 21 22 23
cornea epithelium
moderate moderate
regionalmoderate expression: see section 04 23 weak expression: see section 01 02 03
naris
weak weak
regionalweak expression: see section 12 13 14 15 16 17
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 08 09 10 11 12 13 15 16 17 18 19
esophagus
weak weak
regionalweak expression: see section 11 12
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 16 17
lower jaw molar
weak weak
regionalweak expression: see section 06 07 19
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 16 17
upper jaw molar
weak weak
regionalweak expression: see section 07 19
bladder
weak weak
regionalweak expression: see section 14 15
urethra of male
weak weak
regionalweak expression: see section 15 16
larynx
weak weak
regionalweak expression: see section 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36534
Entity Detected:Jag2, jagged 2 ( MGI:1098270)
Sequence:sense strand is shown

>T36534
CAGGAAGTGGTCATATTCACGAGGCCCTGCTGGTCCCGGGGAATGTCCTTCCCGCATGGGAGTTCCTGGA
TGGAAGACTGCAACAGCTGCCGCTGCCTGGATGGCCACCGGGATTGTAGCAAGGTATGGTGCGGATGGAA
GCCTTGCCTGCTCTCTGGTCAGCCCAGCGATCCGAGTGCCCAGTGCCCCCCAGGGCAGCAATGTCAGGAG
AAGGCCGTGGGTCAGTGCTTGCAGCCACCCTGTGAGAACTGGGGGGAGTGTACAGCGGAGGAGCCTCTGC
CACCCAGCACCCCCTGTCAGCCACGGAGCAGTCATTTGGACAACAACTGTGCCCGACTCACACTGCGCTT
CAACCGTGATCAAGTGCCTCAGGGCACCACCGTGGGCGCTATCTGCTCTGGAATCCGAGCCTTGCCTGCC
ACGAGGGCGGCGGCACACGACCGCCTCCTCCTGCTGCTTTGTGATCGAGCATCCTCGGGGGCCAGTGCTG
TGGAGGTGGCTATGTCTTTCAGCCCTGCAAGGGACCTGCCTGACAGCAGCCTGATCCAGAGCACAGCCCA
CGCCATCGTGGCTGCTATCACTCAGAGAGGAAATAGCTCACTGCTGCTGGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 90126. Forward Primer - name:090126_F_cDNA_Jag2, sequence:CAGGAAGTGGTCATATTCACGA; Reverse Primer - name:090126_N_SP6_cDNA_Jag2, sequence:AGCCAGCAGCAGTGAGCTATT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12279 same embryo
 EurExpress:euxassay_011055 same experiment
 MGI:4825672 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS