Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12317

Ribc2 RIB43A domain with coiled-coils 2 ( MGI:1914997)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12317 EMAGE:12317 EMAGE:12317 EMAGE:12317 EMAGE:12317
"Pseudo-wholemount" of euxassay_011227. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011227_01 euxassay_011227_02 euxassay_011227_03 euxassay_011227_04
EMAGE:12317 EMAGE:12317 EMAGE:12317 EMAGE:12317 EMAGE:12317
euxassay_011227_05 euxassay_011227_06 euxassay_011227_07 euxassay_011227_08 euxassay_011227_09
EMAGE:12317 EMAGE:12317 EMAGE:12317 EMAGE:12317 EMAGE:12317
euxassay_011227_10 euxassay_011227_11 euxassay_011227_12 euxassay_011227_13 euxassay_011227_14
EMAGE:12317 EMAGE:12317 EMAGE:12317 EMAGE:12317 EMAGE:12317
euxassay_011227_15 euxassay_011227_16 euxassay_011227_17 euxassay_011227_18 euxassay_011227_19
EMAGE:12317 EMAGE:12317 EMAGE:12317 EMAGE:12317 EMAGE:12317
euxassay_011227_20 euxassay_011227_21 euxassay_011227_22 euxassay_011227_23 euxassay_011227_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12317Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12317_wholemount_strong.wlz
12317_wholemount_moderate.wlz
12317_wholemount_weak.wlz
12317_wholemount_possible.wlz
12317_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12317_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 19 20 21 22 23 24 moderate expression: see section 09
cervical intervertebral disc
moderate moderate
regionalmoderate expression: see section 08 12 14 15
lumbar intervertebral disc
moderate moderate
regionalmoderate expression: see section 13 15
thoracic intervertebral disc
moderate moderate
regionalmoderate expression: see section 12 13 14 15
diaphragm
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
humerus
strong strong
regionalstrong expression: see section 21 22 23 24 moderate expression: see section 01 02 03 04 05 06
femur
moderate moderate
regionalmoderate expression: see section 22 23 24 weak expression: see section 04 05 06 07 20 21
ilio-psoas
strong strong
regionalstrong expression: see section 20 21 moderate expression: see section 07 08 19 22 weak expression: see section 06
mandible
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 16 17 18 19 20 21 22 23
maxilla
strong strong
regionalstrong expression: see section 06 10 11 12 13 17 18 19 20 21 22 23
bladder
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
sacral vertebral cartilage condensation
moderate moderate
regionalmoderate expression: see section 13 14 15
exoccipital bone
strong strong
regionalstrong expression: see section 04 moderate expression: see section 05 06 07 21 22 weak expression: see section 08 18 19 20
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 23 24 moderate expression: see section 05 06 07 21 22 weak expression: see section 08 18 19 20
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 23 24 moderate expression: see section 06 21 22
clavicle
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 17 18 19 20
scapula
moderate moderate
regionalmoderate expression: see section 02 03 04 22 23 24
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37389
Entity Detected:Ribc2, RIB43A domain with coiled-coils 2 ( MGI:1914997)
Sequence:sense strand is shown

>T37389
AAGAAGCGGTACATTGACCTGTGCAGGCAGGGACGGATCTTCGACGCCAGGAACAGGATCATTGGGGGAG
ACACACAAGCCTGGGATTTTCAAGTCCGTGACCAGAAGATAAAAGAAATAACTGACAAAGCTAGGCATGA
AGCCTTTGCTGCTGAAATGAAGCACAATGACAAAGTCATGTGCATGGCGCATGACCGGGAACAGAGGCAC
AGGAAACAGCTGTGTAGAGCTATCAATGACTTCCAGCAGAACTTTCAGAAGCCAGAAACTCGACGTGAGT
TTGATCTTTCTGACCCCCTGGCCCTCCAGAAAGAGCTTCCAGCCCGCATTTCAGACAATGACATGCGGAA
CACCATATCAGGAATGCAGAAGTTCATGGGAGAGGATTTAAACTTCCAAGAGAGGAGGAGGTTCCAAAAG
GAACAGAGCAGAGAATGGTTTCTGCAGCAGCATGGGGAACGGGAGAAAGCCCGGGCTGACCACCTACTGG
CAGAACACCTCCACACTCAGACGAGACTCAAGTTTGATGAAACAGCCAGAGAGTTGATGAAGCTGGAAGG
CTCCACCAGGAAGGAAGTCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88006. Forward Primer - name:088006_F_cDNA_4930579A10Rik, sequence:AAGAAGCGGTACATTGACCTGT; Reverse Primer - name:088006_N_SP6_cDNA_4930579A10Rik, sequence:CAGACTTCCTTCCTGGTGGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12315 same embryo
 EMAGE:12319 same embryo
 EMAGE:12320 same embryo
 EMAGE:12318 same embryo
 EMAGE:12316 same embryo
 EurExpress:euxassay_011227 same experiment
 MGI:4827741 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS