Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12364

4921510H08Rik RIKEN cDNA 4921510H08 gene ( MGI:1913966)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12364 EMAGE:12364 EMAGE:12364 EMAGE:12364 EMAGE:12364
"Pseudo-wholemount" of euxassay_011210. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011210_01 euxassay_011210_02 euxassay_011210_03 euxassay_011210_04
EMAGE:12364 EMAGE:12364 EMAGE:12364 EMAGE:12364 EMAGE:12364
euxassay_011210_05 euxassay_011210_06 euxassay_011210_07 euxassay_011210_08 euxassay_011210_09
EMAGE:12364 EMAGE:12364 EMAGE:12364 EMAGE:12364 EMAGE:12364
euxassay_011210_10 euxassay_011210_11 euxassay_011210_12 euxassay_011210_13 euxassay_011210_14
EMAGE:12364 EMAGE:12364 EMAGE:12364 EMAGE:12364 EMAGE:12364
euxassay_011210_15 euxassay_011210_16 euxassay_011210_17 euxassay_011210_18 euxassay_011210_19
EMAGE:12364
euxassay_011210_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12364Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12364_wholemount_strong.wlz
12364_wholemount_moderate.wlz
12364_wholemount_weak.wlz
12364_wholemount_possible.wlz
12364_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12364_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forebrain
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
hindbrain
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 18 19
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 15 16 17 18 19
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 16
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 16 17 18 moderate expression: see section 08
spinal cord
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 09 10 11 12 15 16 17 18 moderate expression: see section 13
neural retina
strong strong
regionalstrong expression: see section 01 02 03 moderate expression: see section 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37344
Entity Detected:4921510H08Rik, RIKEN cDNA 4921510H08 gene ( MGI:1913966)
Sequence:sense strand is shown

>T37344
CCCACCTCTTATAGCATTCCAGAGCCCCCTGTGCCCAGCACAGATGATCCGGGCCTATGGTCTGCACCCA
CTCTGCGTTTGCTGCTGCTCCTGCTGGAGCGGACCCTGGAACCCCGGCTGGGAGAGACCCCCGGGTAGAA
AGAAGCGCTGGGGACGCAGGGGTCGTGGCCTGCGCCGCCACCCTCGTCGCTCCTTTCCGAGGAATCCACC
AATAGACCTGAGCAAGATGCTTCGCCCGGTCAACCTTTCCGGGTGGCGGGCACCTGGGATGAGAGCGCCA
CGGAACACCACCCAGTTCATCATGAACCAGGTCTATGAAGACATGAGGCAGCAAGAGAAGCTGGAGCGCC
AGCAGGCAGCATTGAGGGCACAGCAAGCCCAGGAGGGTGGCATCTCCCCAGGAGACTCCACTACCAATGA
TGCGCCCCACAGCGGCGTCGAAGAAGATTCGCAGTTGCCGGAAGATCTGTATGGCTTCATGCAGGATCCC
TCTCTAACCTTTAGTCCTGCTCTAATGCAGCACAACCAGTCTCCTACCCCAGGGCTGGTAGAGGAAGAGG
AGAAAAATGTTGATGATGATGAGTGTGACGTAGAGGTTTGTGATGAAAAAGAGGAGAGCGAGGAGGAGGA
GGAGGAGGAAGTGGACAGAGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 64690. Forward Primer - name:064690_F_cDNA_4921510H08Rik, sequence:CCCACCTCTTATAGCATTCCAG; Reverse Primer - name:064690_N_SP6_cDNA_4921510H08Rik, sequence:CCCTCTGTCCACTTCCTCCTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12363 same embryo
 EMAGE:12361 same embryo
 EMAGE:12362 same embryo
 EMAGE:12365 same embryo
 EurExpress:euxassay_011210 same experiment
 MGI:4822715 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS