Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12466

Gprasp2 G protein-coupled receptor associated sorting protein 2 ( MGI:2442071)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12466 EMAGE:12466 EMAGE:12466 EMAGE:12466 EMAGE:12466
"Pseudo-wholemount" of euxassay_011267. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011267_01 euxassay_011267_02 euxassay_011267_03 euxassay_011267_04
EMAGE:12466 EMAGE:12466 EMAGE:12466 EMAGE:12466 EMAGE:12466
euxassay_011267_05 euxassay_011267_06 euxassay_011267_07 euxassay_011267_08 euxassay_011267_09
EMAGE:12466 EMAGE:12466 EMAGE:12466 EMAGE:12466 EMAGE:12466
euxassay_011267_10 euxassay_011267_11 euxassay_011267_12 euxassay_011267_13 euxassay_011267_14
EMAGE:12466 EMAGE:12466 EMAGE:12466 EMAGE:12466 EMAGE:12466
euxassay_011267_15 euxassay_011267_16 euxassay_011267_17 euxassay_011267_18 euxassay_011267_19
EMAGE:12466 EMAGE:12466 EMAGE:12466 EMAGE:12466 EMAGE:12466
euxassay_011267_20 euxassay_011267_21 euxassay_011267_22 euxassay_011267_23 euxassay_011267_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12466Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12466_wholemount_strong.wlz
12466_wholemount_moderate.wlz
12466_wholemount_weak.wlz
12466_wholemount_possible.wlz
12466_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12466_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 11 12 13 15 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
not examined not examined
homogeneousnot examined expression: see section 18 19 20
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 06 20 21 22
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 19 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 09 weak expression: see section 18
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16
neural retina
weak weak
regionalweak expression: see section 01 02 03 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37441
Entity Detected:Gprasp2, G protein-coupled receptor associated sorting protein 2 ( MGI:2442071)
Sequence:sense strand is shown

>T37441
GGACCGAAGAAAAGCCTAGTTTGGGGGCTGTGGCCAGAGATGAGGTCAGGCCTGAGTCTGAAGAAGAGGC
ACTATTTGGGTCCTGGTTTTGGGATAGGGATGAGGCCTGCTTTGACCCAAATCCTACTCCTGTGTACACA
GCTAAGAGCAGGTACAGAGATCCAGAAGAGGATCTTAATTTAGCATCCAGGCCCAAAACCTGGGACGAGG
TTACCATCGAATTCAAACCTCCTTGCCATGGGCTTGGGTTCCCTTCCCCAAGACCCTTTATCATTCCTGA
AGGGGCTTCTGGAAATAGTGAGGAAAAAGCCAAGAATGCAGAGCTTGGCGCAGAGGGGGAAGAGCAGGAC
TCTGTGGCTCAGCGTGATCTTCCTGAACCCGAGTTTCCATTTCAGTATGATCCCTCTTACCGCTCAGTCC
AGGAAATTCGCGAGCATCTTAAGGCCAGGGAAAGTGCACAGCCAGAGAATTGGTCTTGCACCTGCATCCA
GTGTGAGCTTAGAATTAGTTCTGCAGAATTTGAGGAGCTTCTTTTACTGATGGACAGGATTCGTGATCCT
TTTATCCATGAGATAGCTAAGATTGCAATGGGCATGAGAACTGCTTCTCAGTTTACCCGGGATTTCATTC
G
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 86861. Forward Primer - name:086861_F_cDNA_5330440H13Rik, sequence:GGACCGAAGAAAAGCCTAGTTT; Reverse Primer - name:086861_N_SP6_cDNA_5330440H13Rik, sequence:CGAATGAAATCCCGGGTAAAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12469 same embryo
 EMAGE:12467 same embryo
 EMAGE:12464 same embryo
 EMAGE:12468 same embryo
 EMAGE:12465 same embryo
 EurExpress:euxassay_011267 same experiment
 MGI:4825198 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS