Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12477

Snap29 synaptosomal-associated protein 29 ( MGI:1914724)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12477 EMAGE:12477 EMAGE:12477 EMAGE:12477 EMAGE:12477
"Pseudo-wholemount" of euxassay_011249. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011249_01 euxassay_011249_02 euxassay_011249_03 euxassay_011249_04
EMAGE:12477 EMAGE:12477 EMAGE:12477 EMAGE:12477 EMAGE:12477
euxassay_011249_05 euxassay_011249_06 euxassay_011249_07 euxassay_011249_08 euxassay_011249_09
EMAGE:12477 EMAGE:12477 EMAGE:12477 EMAGE:12477 EMAGE:12477
euxassay_011249_10 euxassay_011249_11 euxassay_011249_12 euxassay_011249_13 euxassay_011249_14
EMAGE:12477 EMAGE:12477 EMAGE:12477 EMAGE:12477 EMAGE:12477
euxassay_011249_15 euxassay_011249_16 euxassay_011249_17 euxassay_011249_18 euxassay_011249_19
EMAGE:12477 EMAGE:12477 EMAGE:12477 EMAGE:12477
euxassay_011249_20 euxassay_011249_21 euxassay_011249_22 euxassay_011249_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12477Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12477_wholemount_strong.wlz
12477_wholemount_moderate.wlz
12477_wholemount_weak.wlz
12477_wholemount_possible.wlz
12477_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12477_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 14 15
pons mantle layer
weak weak
regionalweak expression: see section 07 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 18 19 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16 17
ventral grey horn
weak weak
regionalweak expression: see section 09 10 12 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 15 16
neural retina
weak weak
regionalweak expression: see section 01 02 03 22
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 13 14 15 16
vomeronasal organ
weak weak
regionalweak expression: see section 11 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1079
Entity Detected:Snap29, synaptosomal-associated protein 29 ( MGI:1914724)
Sequence:sense strand is shown

>T1079
GTTGGCCTACTGGAAAGTAGTGCGCGCGGCGTCCACAGTGAATCCGCCCGCCGGCGCTGGGCTATCGACT
CCTCGCTCAGCAACCCCTCCTGCTTCCTAGGTGCAGGCCGTCTCCCGCACCATGTCTGGCTATCCTAAAA
GCTATAATCCTTTCGACGATGACGTGGAAGAGGAAGACACCCGGCCCGCGCCGTGGAAGGACGTCCGCGA
CCTGCCTGACGGCCCCGACGCGCCCATTGACAGGCAGCAGTACCTGAGACAGGAGGTGTTGCGCAGGGCC
GAGGCTACCGCTGCCAGTACCAGCAGGTCCTTGTCTCTCATGTATGAATCGGAGAAGATCGGAGTCGCCT
CTTCCGAGGAGCTGGTCCGGCAGCGAGGAGTCCTAGAACACACAGAGAAGATGGTAGACAAGATGGATCA
GGATTTGAAGATGAGCCAGAAACATATCAACAGCATTAAGAGTGTGTTTGGAGGATTTATCAACTACTTC
AAATCCAAACCAGTAGAGCCTCCACCTGAGCAGAATGGCAGCATCGTCTCCCAGCCCAACAGCAGATTGA
AAGAAGCCATAAATA
Notes:The probe template was PCR amplified from IMAGE:2099924 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2099924 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12478 same embryo
 EMAGE:12480 same embryo
 EMAGE:12482 same embryo
 EMAGE:12479 same embryo
 EMAGE:12481 same embryo
 EurExpress:euxassay_011249 same experiment
 MGI:4828343 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS