Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12479

Slc39a8 solute carrier family 39 (metal ion transporter), member 8 ( MGI:1914797)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12479 EMAGE:12479 EMAGE:12479 EMAGE:12479 EMAGE:12479
"Pseudo-wholemount" of euxassay_011277. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011277_01 euxassay_011277_02 euxassay_011277_03 euxassay_011277_04
EMAGE:12479 EMAGE:12479 EMAGE:12479 EMAGE:12479 EMAGE:12479
euxassay_011277_05 euxassay_011277_06 euxassay_011277_07 euxassay_011277_08 euxassay_011277_09
EMAGE:12479 EMAGE:12479 EMAGE:12479 EMAGE:12479 EMAGE:12479
euxassay_011277_10 euxassay_011277_11 euxassay_011277_12 euxassay_011277_13 euxassay_011277_14
EMAGE:12479 EMAGE:12479 EMAGE:12479 EMAGE:12479 EMAGE:12479
euxassay_011277_15 euxassay_011277_16 euxassay_011277_17 euxassay_011277_18 euxassay_011277_19
EMAGE:12479 EMAGE:12479 EMAGE:12479 EMAGE:12479
euxassay_011277_20 euxassay_011277_21 euxassay_011277_22 euxassay_011277_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12479Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12479_wholemount_strong.wlz
12479_wholemount_moderate.wlz
12479_wholemount_weak.wlz
12479_wholemount_possible.wlz
12479_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12479_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
brain
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 21 22
diencephalon meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17
telencephalon meninges
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
hindbrain meninges
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
spinal cord
strong strong
spottedstrong expression: see section 08 09 10 11 12 13 14 15 16
spinal cord meninges
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16
saccule
moderate moderate
regionalmoderate expression: see section 05 06 18
cochlea
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 16 17 18 19
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 17 18 weak expression: see section 10 19
midgut
moderate moderate
regionalmoderate expression: see section 13 14 15 16 weak expression: see section 07 08 09 10 11 12
lower jaw incisor
strong strong
regionalstrong expression: see section 11 12 15
upper jaw incisor
strong strong
regionalstrong expression: see section 11 16
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
urinary system
moderate moderate
regionalmoderate expression: see section 05 20 21
maturing glomerular tuft
moderate moderate
regionalmoderate expression: see section 08 09 18 19 weak expression: see section 17
lung
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1080
Entity Detected:Slc39a8, solute carrier family 39 (metal ion transporter), member 8 ( MGI:1914797)
Sequence:sense strand is shown

>T1080
TCCTCGAGACTGTTGGCCTACTGGGCTTTATATCCGGGACAAGCGAGAGTCACCACACTGCTCCGCAGGA
GGCTCCGAGAGGCCACACTGCCTATCGCCCTTCTGGCTGTTCTGCCTCTTCAATGCCCCGAAGGTCTGAG
ACTGCAGAGCGGGGGCACGGAGTGTCTCGCTAACTGGGCCAGGCAGTGACGCGGGACCGGCGCACCCTCC
CACCCCCACCCTAACGGCACTGACACCGGGGCACCGGCGCGGGTCCCTGCATCAGCTAGCTCCGGAGCTG
CGCGCTCCACGATGGCTCCGGGCCGGGCAGTGGCCGGGCTGCTGCTGCTGGCGGCCACCAGCCTGGGACA
CCCCTCGGAGGGACCGGAGCTCGCCTTCAGTGAGGATGTGCTGAGCGTGTTCGGCGCCAACCGGAGCCTG
TCGGCCGCGCAGCTGGGGCGCCTGCTGGAGCGTCTGGGGGCTGCATCCCAGCAGGGAGCGCTGGACCTGG
GCCAGCTGCACTTCAACCAGTGTTTGTCAGCAGAAGACATCTTTTCTCTTCATGGTTTCTCAAATGTCAC
CCA
Notes:The probe template was PCR amplified from IMAGE:2099925 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2099925 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12477 same embryo
 EMAGE:12478 same embryo
 EMAGE:12480 same embryo
 EMAGE:12482 same embryo
 EMAGE:12481 same embryo
 EurExpress:euxassay_011277 same experiment
 MGI:4828226 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS