Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12489

Amd2 S-adenosylmethionine decarboxylase 2 ( MGI:1333111)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12489 EMAGE:12489 EMAGE:12489 EMAGE:12489 EMAGE:12489
"Pseudo-wholemount" of euxassay_011311. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011311_01 euxassay_011311_02 euxassay_011311_03 euxassay_011311_04
EMAGE:12489 EMAGE:12489 EMAGE:12489 EMAGE:12489 EMAGE:12489
euxassay_011311_05 euxassay_011311_06 euxassay_011311_07 euxassay_011311_08 euxassay_011311_09
EMAGE:12489 EMAGE:12489 EMAGE:12489 EMAGE:12489 EMAGE:12489
euxassay_011311_10 euxassay_011311_11 euxassay_011311_12 euxassay_011311_13 euxassay_011311_14
EMAGE:12489 EMAGE:12489 EMAGE:12489 EMAGE:12489 EMAGE:12489
euxassay_011311_15 euxassay_011311_16 euxassay_011311_17 euxassay_011311_18 euxassay_011311_19
EMAGE:12489 EMAGE:12489 EMAGE:12489 EMAGE:12489
euxassay_011311_20 euxassay_011311_21 euxassay_011311_22 euxassay_011311_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12489Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12489_wholemount_strong.wlz
12489_wholemount_moderate.wlz
12489_wholemount_weak.wlz
12489_wholemount_possible.wlz
12489_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12489_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 17 18 19 20 21
thyroid gland
moderate moderate
regionalmoderate expression: see section 12 13 16 17
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 14
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10
rectum
moderate moderate
regionalmoderate expression: see section 15
midgut
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
lower jaw incisor
strong strong
regionalstrong expression: see section 12 13 14 17 18
lower jaw molar
strong strong
regionalstrong expression: see section 07 08 20 21
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13 14 17 18
upper jaw molar
strong strong
regionalstrong expression: see section 07 08 20 21
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
metanephros
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 18 19 20 21 22 23
left lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12
right lung
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37558
Entity Detected:Amd2, S-adenosylmethionine decarboxylase 2 ( MGI:1333111)
Sequence:sense strand is shown

>T37558
GTGACAAAGACTGACAAGCAGGAAGCTTATGTACTCAGTGAGAGTAGCATATTTGTCTCCAAGAGACGTT
TCATTTTGAAGACATGTGGTACCACCCTCTTACTGAAAGCACTGGTTCCCCTGTTGAAGCTTGCTAGGGA
TTACAGTGGGTTTGACTCAATTCAAAGCTTCTTTTATTCTCGTAAGAATTTCATGAAGCCTTCTCACCAA
GGGTACCCACACCGGAATTTCCAGGAAGAAATCGAGTTTCTTAATGTAATTTTCCCAAATGGAGCAGCAT
ATTGTATGGGACGCATGAATTCTGACTGCTGGTACTTGTATACTTTGGATTTCCCAGAGAGCCGAGTAAT
CAGTCAGCCAGATCAAACCCTGGAAATTCTGATGAGTGAGCTTGACCCAGCAGTTATGGACCAGTTCTAC
ATGAAAGATGGTGTTACTGCAAAGGATGTCACTCGTGAGAGTGGAATTCGTGACCTGATACCAGGTTCTG
TCATTGATGCCACACTGTTCAATCCTTGTGGCTACTCGATGAATGGAATGAAATCGGATGGAACATATTG
GACTATTCACATCACTCCAGAACCAGAATTTTCTTATGTTAGCTTTGAAACAAACCTAAGTCAGACCTCC
TATGACGACCTGATCAGGAAAGTTGTGGAAGTCTTCAAGCCAGGAAAATTTGTGACCACCTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100174. Forward Primer - name:100174_F_cDNA_Amd2, sequence:GTGACAAAGACTGACAAGCAGG; Reverse Primer - name:100174_N_SP6_cDNA_Amd2, sequence:CAAGGTGGTCACAAATTTTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12488 same assay
 EMAGE:12490 same embryo
 EMAGE:12487 same embryo
 EurExpress:euxassay_011311 same experiment
 EMAGE:12491 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS