Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12499

4930539E08Rik RIKEN cDNA 4930539E08 gene ( MGI:1925441)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12499 EMAGE:12499 EMAGE:12499 EMAGE:12499 EMAGE:12499
"Pseudo-wholemount" of euxassay_011200. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011200_01 euxassay_011200_02 euxassay_011200_03 euxassay_011200_04
EMAGE:12499 EMAGE:12499 EMAGE:12499 EMAGE:12499 EMAGE:12499
euxassay_011200_05 euxassay_011200_06 euxassay_011200_07 euxassay_011200_08 euxassay_011200_09
EMAGE:12499 EMAGE:12499 EMAGE:12499 EMAGE:12499 EMAGE:12499
euxassay_011200_10 euxassay_011200_11 euxassay_011200_12 euxassay_011200_13 euxassay_011200_14
EMAGE:12499 EMAGE:12499 EMAGE:12499 EMAGE:12499 EMAGE:12499
euxassay_011200_15 euxassay_011200_16 euxassay_011200_17 euxassay_011200_18 euxassay_011200_19
EMAGE:12499 EMAGE:12499 EMAGE:12499 EMAGE:12499 EMAGE:12499
euxassay_011200_20 euxassay_011200_21 euxassay_011200_22 euxassay_011200_23 euxassay_011200_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12499Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12499_wholemount_strong.wlz
12499_wholemount_moderate.wlz
12499_wholemount_weak.wlz
12499_wholemount_possible.wlz
12499_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12499_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 23 24 weak expression: see section 01 13 21 22
facial vii ganglion
moderate moderate
single cellmoderate expression: see section 05 06 20 21
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 07 08 19 20
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
moderate moderate
single cellmoderate expression: see section 09 18
vestibulocochlear viii ganglion
moderate moderate
single cellmoderate expression: see section 07 08 18 19
spinal cord
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16 17 18 weak expression: see section 13
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 08 09 10 11 12 16 17 18
neural retina
weak weak
regionalweak expression: see section 01 02 03 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37373
Entity Detected:4930539E08Rik, RIKEN cDNA 4930539E08 gene ( MGI:1925441)
Sequence:sense strand is shown

>T37373
ATCACAGAGAAAGGAGCCTCTGTTGAGGAAATGCCTCCATGAGATCCAGCTGTAAGGCATTTTCTCAACT
AGTGATCAAGGGGGGAGGGCCCAGCCCAGTGTGGGTGGGGCCATCCTTGGGCTGGTGGTCCTGGGTTCTA
CAAGAAGGTAGGCTGAGCAAGCCACGGGGAGCAAGCCAGTAAGTAGCCCCGCTCTGTGGTGTCTGCTTCA
GCTCCTGCCTCCAGGTTCCTGCCCTGTGTGAGTTCCTGTCCTGACTTCCTTTGGTGATGAACCTCGATTT
GGAAGTGTAAGCAGGTTAAACCCTTTCCTCTCAATTTACATTTTGGTCACAGTGTTGGGTTAGAAACCCT
GACTAAGACACCATTATCACTGATGGCTGGGACGTGTTTGGCCCTCTTGTGGATGTGTCTATCTGCACAA
TTGTGAGATGTGGCCAGTGACATAGATACGCATATTCGTCACACGTCCATACCCACACACAGGAGCTGGG
GCCATTGACTCCCTGGGCTATTGGCAGGAAAGTGTGACCATGGGGGAGGGTATCAAAGCCTGGGTGGCAG
AGTGAGTCTCGTAAGCCTTGGAGACTATTGGTGGCCACAGCAGGCTCATGGCACCTGGGCTGAATGGCTT
CATTCATGGCAGCTGAATGGAGGTAGGAAGGCCTGGCTCTCAGGTGGAGGCAGTCTCAAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 67127. Forward Primer - name:067127_F_cDNA_4930539E08Rik, sequence:ATCACAGAGAAAGGAGCCTCTG; Reverse Primer - name:067127_N_SP6_cDNA_4930539E08Rik, sequence:CTTGAGACTGCCTCCACCTGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12503 same embryo
 EMAGE:12500 same embryo
 EMAGE:12504 same embryo
 EMAGE:12502 same embryo
 EMAGE:12501 same embryo
 EurExpress:euxassay_011200 same experiment
 MGI:4822734 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS