Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12501

Sphkap SPHK1 interactor, AKAP domain containing ( MGI:1924879)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12501 EMAGE:12501 EMAGE:12501 EMAGE:12501 EMAGE:12501
"Pseudo-wholemount" of euxassay_011158. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011158_01 euxassay_011158_02 euxassay_011158_03 euxassay_011158_04
EMAGE:12501 EMAGE:12501 EMAGE:12501 EMAGE:12501 EMAGE:12501
euxassay_011158_05 euxassay_011158_06 euxassay_011158_07 euxassay_011158_08 euxassay_011158_09
EMAGE:12501 EMAGE:12501 EMAGE:12501 EMAGE:12501 EMAGE:12501
euxassay_011158_10 euxassay_011158_11 euxassay_011158_12 euxassay_011158_13 euxassay_011158_14
EMAGE:12501 EMAGE:12501 EMAGE:12501 EMAGE:12501 EMAGE:12501
euxassay_011158_15 euxassay_011158_16 euxassay_011158_17 euxassay_011158_18 euxassay_011158_19
EMAGE:12501 EMAGE:12501 EMAGE:12501 EMAGE:12501
euxassay_011158_20 euxassay_011158_21 euxassay_011158_22 euxassay_011158_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12501Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12501_wholemount_strong.wlz
12501_wholemount_moderate.wlz
12501_wholemount_weak.wlz
12501_wholemount_possible.wlz
12501_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12501_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
foot
weak weak
regionalweak expression: see section 01 02 03 22 23
pancreas
weak weak
regionalweak expression: see section 10 11
pineal primordium
moderate moderate
regionalmoderate expression: see section 13
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 14 15 weak expression: see section 10 11
cerebral cortex mantle layer
moderate moderate
single cellmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 17 18 19 20 21 22
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15 16 17 23
olfactory cortex marginal layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 15 16 17
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 13 14 15 17 weak expression: see section 08 09 10 11 12
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 13 14 15 17 weak expression: see section 08 09 10 11 12
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 13 14 15 17 18 weak expression: see section 08 09 10 11 12
midbrain mantle layer
weak weak
spottedweak expression: see section 07 08 09 14 17 18
tegmentum
moderate moderate
regionalmoderate expression: see section 09 10 11 14 15 16
trigeminal v ganglion
weak weak
spottedweak expression: see section 05 06 07 08 18 19 20
spinal cord mantle layer
weak weak
regionalweak expression: see section 10 11 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37375
Entity Detected:Sphkap, SPHK1 interactor, AKAP domain containing ( MGI:1924879)
Sequence:sense strand is shown

>T37375
ACTGACCAGATCACAAACATGCTAATTCATGAAACATGGGCCAGCTCCATTGAGGCTCTCATGAGAAAGA
ACAAAATCATTGCTGATGATAGCGAGGCAGCTAATGCCAGTCCTGGCCCTGTTTCCAGTGGTTCTCCTTT
GCAAGTAGAGAAGAATGCCAACAGATTAGCCACCAGCAAAGGACACAGGGGGCCAACTCTGCTTGTACAG
GAATCTGTTGATTACCAGAGAAAAGATGCTGTTACTGAAGGCAATCATTCCCCAGTGTCATCTCCAGGCA
AAACAGCTCCTGTTAAAAAACCCAGTGATTTTGATCCTAGAAGAGAAACCTCTGCATGCCACAATGCTGC
TGGTCTCAACAGCCCTAGGCGGTCACTCTGCTCAAGGGATGTGCCTTTGATTCAGATAGAGACAGATCAG
AAAGAAGAGTGCATTGGAGAACCTGGACCTTTCCTTTCCCAAAGTGGCTCCCTAGAGGAAACAGAAGGCC
ACCAACCTGAAGAAACCATCCCAGATGTGGCCAGAAATGAAGACACAGCTCCGAGCACCTGTCAGAGCTC
TCGTGAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 67097. Forward Primer - name:067097_F_cDNA_4930544G21Rik, sequence:ACTGACCAGATCACAAACATGC; Reverse Primer - name:067097_N_SP6_cDNA_4930544G21Rik, sequence:GTCACGAGAGCTCTGACAGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12503 same embryo
 EMAGE:12500 same embryo
 EMAGE:12504 same embryo
 EMAGE:12502 same embryo
 EMAGE:12499 same embryo
 EurExpress:euxassay_011158 same experiment
 MGI:4828410 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS