Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12570

Tbc1d19 TBC1 domain family, member 19 ( MGI:1914499)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12570 EMAGE:12570 EMAGE:12570 EMAGE:12570 EMAGE:12570
"Pseudo-wholemount" of euxassay_011544. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011544_01 euxassay_011544_02 euxassay_011544_03 euxassay_011544_04
EMAGE:12570 EMAGE:12570 EMAGE:12570 EMAGE:12570 EMAGE:12570
euxassay_011544_05 euxassay_011544_06 euxassay_011544_07 euxassay_011544_08 euxassay_011544_09
EMAGE:12570 EMAGE:12570 EMAGE:12570 EMAGE:12570 EMAGE:12570
euxassay_011544_10 euxassay_011544_11 euxassay_011544_12 euxassay_011544_13 euxassay_011544_14
EMAGE:12570 EMAGE:12570 EMAGE:12570 EMAGE:12570 EMAGE:12570
euxassay_011544_15 euxassay_011544_16 euxassay_011544_17 euxassay_011544_18 euxassay_011544_19
EMAGE:12570 EMAGE:12570 EMAGE:12570 EMAGE:12570 EMAGE:12570
euxassay_011544_20 euxassay_011544_21 euxassay_011544_22 euxassay_011544_23 euxassay_011544_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12570Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12570_wholemount_strong.wlz
12570_wholemount_moderate.wlz
12570_wholemount_weak.wlz
12570_wholemount_possible.wlz
12570_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12570_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 17 18
pons mantle layer
weak weak
regionalweak expression: see section 08 19
facial vii ganglion
weak weak
regionalweak expression: see section 06 22 23 24
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 11 19 20 21 22 23 24
vagus x ganglion
weak weak
regionalweak expression: see section 09 19
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 08 20
ventral grey horn
weak weak
regionalweak expression: see section 11 12 13 16 17
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30985
Entity Detected:Tbc1d19, TBC1 domain family, member 19 ( MGI:1914499)
Sequence:sense strand is shown

>T30985
TGTGCGTATTGGGCAGAAAGTTCTAGCGCAGCAGGACAGCGCTGCTGCTCAGCAGTACATCCGACAAGGA
AGTCCCACAGCACTGAGAGCTGAGCTCTGGGCGCTCATTCTGAATATCTCCAGTCAGCCTGAGGATATCC
TGTATTATGAGCAGCTTAAGACCAATGTGATCCAGCACGACCTTTTGGTGGACAGTCTAATTTATAAAGA
TGTGAAGCTGACAGCGAGCAATGATGATTACTATTTTGTATTTGAAGATTATTTATATCAGGTGTTACTT
TGCTTTTCACGGGATACGTCTGTACTGGGCCACTTTGCATACAACAGTGCTTCACCGCCGAAGTCATACA
TCAGAGGAAAACTAGGATTAGAAGAATATGCTGTTTTCTATCCGCCCAATGGTGTCATCCCTTTCCATGG
GTTTTCCATGTATGTTGCACCATTGTGTTTTCTGTATCATGAACCTTACAAATTGTATCAGATATTCCGT
GAGATGTACGTCCGCTTTTTCTTCAGACTCCACTCCATCTCCTCTCATCCTTCTGGTATTGTGTCACTCT
GTTTGCTGTTTGAAACTCTTCTTCAAACGTATCTTCCCCAACTCTTTTATCATCTGCGAGAAATTGGAGC
TCAACCACTTCGGATATCATTTAAATGGATGGTTCGAGCTTTTTCTGGATACTTAGCTACAGACCAACTC
TTGCTTTTATGGGATAGAATTCTAGGATACAACTCTCTGGAAATACTTGCTGTGCTGGCAGCTGCCGTGT
TTGCTTTCCGAGCAGTGAACCTGATGGAGGTGACATCACTGGCTGCAGCT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3983701), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 21906. Forward Primer - name:021906_F_IRAV32-35_C16_2810453K03Rik, sequence:TGTGCGTATTGGGCAGAA; Reverse Primer - name:021906_R_SP6_IRAV32-35_C16_2810453K03Rik, sequence:CAGCTGCAGCCAGTGATG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12571 same embryo
 EMAGE:12568 same embryo
 EMAGE:12569 same embryo
 EMAGE:12572 same embryo
 EurExpress:euxassay_011544 same experiment
 MGI:4828606 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS