Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12573

Frzb frizzled-related protein ( MGI:892032)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12573 EMAGE:12573 EMAGE:12573 EMAGE:12573 EMAGE:12573
"Pseudo-wholemount" of euxassay_011498. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011498_01 euxassay_011498_02 euxassay_011498_03 euxassay_011498_04
EMAGE:12573 EMAGE:12573 EMAGE:12573 EMAGE:12573 EMAGE:12573
euxassay_011498_05 euxassay_011498_06 euxassay_011498_07 euxassay_011498_08 euxassay_011498_09
EMAGE:12573 EMAGE:12573 EMAGE:12573 EMAGE:12573 EMAGE:12573
euxassay_011498_10 euxassay_011498_11 euxassay_011498_12 euxassay_011498_13 euxassay_011498_14
EMAGE:12573 EMAGE:12573 EMAGE:12573 EMAGE:12573 EMAGE:12573
euxassay_011498_15 euxassay_011498_16 euxassay_011498_17 euxassay_011498_18 euxassay_011498_19
EMAGE:12573 EMAGE:12573 EMAGE:12573 EMAGE:12573
euxassay_011498_20 euxassay_011498_21 euxassay_011498_22 euxassay_011498_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12573Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12573_wholemount_strong.wlz
12573_wholemount_moderate.wlz
12573_wholemount_weak.wlz
12573_wholemount_possible.wlz
12573_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12573_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 20 21 22 23 weak expression: see section 03
adrenal gland
strong strong
spottedstrong expression: see section 09 10 17 18 moderate expression: see section 19
spleen primordium
moderate moderate
regionalmoderate expression: see section 03 04 05 06
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 08 09 10 11 13 14 15 16 17 weak expression: see section 07
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 10 14
pons ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 13 14 15 16 weak expression: see section 12
dorsal grey horn
strong strong
single cellstrong expression: see section 10 11 12 13 14 15 16 17 18
intermediate grey horn
strong strong
single cellstrong expression: see section 11 12 13 14 15
aorta
weak weak
regionalweak expression: see section 11 12 13 14
mitral valve
moderate moderate
regionalmoderate expression: see section 11 12
tricuspid valve
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14
mandible
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22
lower jaw incisor
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
lower jaw molar
strong strong
regionalstrong expression: see section 05 06 07 08 16 17 18 19
maxilla
strong strong
regionalstrong expression: see section 04 05 06 07 09 10 11 14 15 16 17 18 19 20
palatal shelf epithelium
strong strong
regionalstrong expression: see section 10 11 13
upper jaw incisor
strong strong
regionalstrong expression: see section 09 10 11 12 13 14
upper jaw molar
strong strong
regionalstrong expression: see section 05 06 07 08 16 17 18 19
renal cortex
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20 21
genital tubercle of male
strong strong
regionalstrong expression: see section 12 14 moderate expression: see section 11 15
testis
strong strong
regionalstrong expression: see section 13
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 moderate expression: see section 03 04 20 21 22 23
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 12 20 21 22 23
clavicle
strong strong
regionalstrong expression: see section 08 09 16 moderate expression: see section 05 06 07 17 18 19
sternum
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30125
Entity Detected:Frzb, frizzled-related protein ( MGI:892032)
Sequence:sense strand is shown

>T30125
TCTCTCCTGAGGCCATCGTCACCGCGGACGGAGCGGATTTTCCTATGGATTCAAGTACTGGACACTGCAG
AGGGGCAAGCAGCGAACGTTGCAAATGTAAGCCTGTCAGAGCTACACAGAAGACCTATTTCCGGAACAAT
TACAACTATGTCATCCGGGCTAAAGTTAAAGAGGTAAAGATGAAATGTCATGATGTGACCGCCGTTGTGG
AAGTGAAGGAAATTCTAAAGGCATCACTGGTAAACATTCCAAGGGACACCGTCAATCTTTATACCACCTC
TGGCTGCCTCTGCCCTCCACTTACTGTCAATGAGGAATATGTCATCATGGGCTATGAAGACGAGGAACGT
TCCAGGTTACTCTTGGTAGAAGGCTCTATAGCTGAGAAGTGGAAGGATCGGCTTGGTAAGAAAGTCAAGC
GCTGGGATATGAAACTCCGACACCTTGGACTGGGTAAAACTGATGCTAGCGATTCCACTCAGAATCAGAA
GTCTGGCAGGAACTCTAATCCCCGGCCAGTACGAAGCTAAATCCTGAAATGTAAAAGGCCACACCCACGG
ACTCCCTTCTAAGACTGGCGCTGCTGGACTAACAAAGGAAAACTGCACAGTTGTGCTCGTGACCGATTGT
TTACCAGACACCGCGTGGCTACAGAAGTTACTGCTGGTCCCCTTTCTCCTGCTTCTTAATGGCCTGGGGT
TAGATCCTTTAATATGTTATATATTTTATTTCATCAATCACGTGGGAACTGTTCTTTTGCAACCAGAATA
GTAAATTAAATATGTTGATGCTAAGGTTTCTGTACTGGACTCCCTGGGTTTAATTTGGTGTTCTGTACCC
CGATTGAGAATGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4237554), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 17575. Forward Primer - name:017575_F_IRAV28-31_D13_Frzb, sequence:TCTCTCCTGAGGCCATCG; Reverse Primer - name:017575_R_SP6_IRAV28-31_D13_Frzb, sequence:TGCATTCTCAATCGGGGT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12576 same embryo
 EMAGE:12575 same embryo
 EMAGE:12574 same embryo
 EurExpress:euxassay_011498 same experiment
 MGI:4824934 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS