Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12591

Magi3 membrane associated guanylate kinase, WW and PDZ domain containing 3 ( MGI:1923484)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12591 EMAGE:12591 EMAGE:12591 EMAGE:12591 EMAGE:12591
"Pseudo-wholemount" of euxassay_011395. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011395_01 euxassay_011395_02 euxassay_011395_03 euxassay_011395_04
EMAGE:12591 EMAGE:12591 EMAGE:12591 EMAGE:12591 EMAGE:12591
euxassay_011395_05 euxassay_011395_06 euxassay_011395_07 euxassay_011395_08 euxassay_011395_09
EMAGE:12591 EMAGE:12591 EMAGE:12591 EMAGE:12591 EMAGE:12591
euxassay_011395_10 euxassay_011395_11 euxassay_011395_12 euxassay_011395_13 euxassay_011395_14
EMAGE:12591 EMAGE:12591 EMAGE:12591 EMAGE:12591 EMAGE:12591
euxassay_011395_15 euxassay_011395_16 euxassay_011395_17 euxassay_011395_18 euxassay_011395_19
EMAGE:12591 EMAGE:12591 EMAGE:12591 EMAGE:12591
euxassay_011395_20 euxassay_011395_21 euxassay_011395_22 euxassay_011395_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12591Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12591_wholemount_strong.wlz
12591_wholemount_moderate.wlz
12591_wholemount_weak.wlz
12591_wholemount_possible.wlz
12591_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12591_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 10
fibula
moderate moderate
regionalmoderate expression: see section 02
tibia
moderate moderate
regionalmoderate expression: see section 01 02
femur
moderate moderate
regionalmoderate expression: see section 02 03
facial vii ganglion
weak weak
regionalweak expression: see section 22
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 08 09 21
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 20
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 14 15 16 17 18
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 11 14
left lung
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16
right lung
weak weak
regionalweak expression: see section 17 18 19 20 21 22 23
axial skeleton
moderate moderate
regionalmoderate expression: see section 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37462
Entity Detected:Magi3, membrane associated guanylate kinase, WW and PDZ domain containing 3 ( MGI:1923484)
Sequence:sense strand is shown

>T37462
ATCGTTGTGGAGGACTGAAAGTTGGAGATCACATCTCTGCTGTGAATGGGCAGTCCATTGTCGACCTATC
CCATGATAATATTGTTCAGCTCATCAAAGATGCTGGAGTCACCGTCACGCTGACAGTGGTTGCTGAAGAA
GAGCATCATGGTCCACCATCAGGAACAAACTCAGCCAGGCAGAGCCCAGCACTACAGCACAGGCCCATGG
GACAAGCACAAGCCAACCACATACCTGGGGACAGAATTGCCCTAGAAGGTGAAATTGGGAGAGATGTCTG
CAGTTCTTACAGACATTCCTGGTCTGACCATAAGCACCTTGCACAGCCTGACACTGCAGTGATTTCAGTT
GTGGGCAGTCGGCACAATCAGAGCCTTGGCTGTTACCCTGTGGAGCTGGAGAGAGGCCCTCGAGGCTTTG
GGTTCAGCCTCCGCGGAGGGAAGGAGTACAACATGGGGCTGTTCATCCTGCGCCTGGCCGAGGACGGGCC
CGCCATCAAAGACGGCAGGATTCACGTTGGTGACCAGATCGTTGAAATCAATGGGGAACCGACACAAGGC
ATCACACACACTCGAGCAATTGAGCTCATTCAGGCTGGTGGGAATAAAGTCCTCCTCCTTCTGAGGCCAG
GAACTGGCTTGATACCTGACCACGGTTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66730. Forward Primer - name:066730_F_cDNA_6530407C02Rik, sequence:ATCGTTGTGGAGGACTGAAAGT; Reverse Primer - name:066730_N_SP6_cDNA_6530407C02Rik, sequence:CAAACCGTGGTCAGGTATCAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12593 same embryo
 EMAGE:12596 same embryo
 EMAGE:12595 same embryo
 EMAGE:12592 same embryo
 EMAGE:12594 same embryo
 EurExpress:euxassay_011395 same experiment
 MGI:4826064 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS