Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12690

Wnt5b wingless-related MMTV integration site 5B ( MGI:98959)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12690 EMAGE:12690 EMAGE:12690 EMAGE:12690 EMAGE:12690
"Pseudo-wholemount" of euxassay_011466. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011466_01 euxassay_011466_02 euxassay_011466_03 euxassay_011466_04
EMAGE:12690 EMAGE:12690 EMAGE:12690 EMAGE:12690 EMAGE:12690
euxassay_011466_05 euxassay_011466_06 euxassay_011466_07 euxassay_011466_08 euxassay_011466_09
EMAGE:12690 EMAGE:12690 EMAGE:12690 EMAGE:12690 EMAGE:12690
euxassay_011466_10 euxassay_011466_11 euxassay_011466_12 euxassay_011466_13 euxassay_011466_14
EMAGE:12690 EMAGE:12690 EMAGE:12690 EMAGE:12690 EMAGE:12690
euxassay_011466_15 euxassay_011466_16 euxassay_011466_17 euxassay_011466_18 euxassay_011466_19
EMAGE:12690 EMAGE:12690 EMAGE:12690 EMAGE:12690 EMAGE:12690
euxassay_011466_20 euxassay_011466_21 euxassay_011466_22 euxassay_011466_23 euxassay_011466_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12690Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12690_wholemount_strong.wlz
12690_wholemount_moderate.wlz
12690_wholemount_weak.wlz
12690_wholemount_possible.wlz
12690_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12690_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 19 20 21 22 23 24 weak expression: see section 07 08 09 10 11 18
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23 24
adrenal cortex
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18
adrenal medulla
moderate moderate
regionalmoderate expression: see section 08 09 10 17 18 19
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 07 08 09 10 16 17 18 19 20
hypothalamus mantle layer
strong strong
homogeneousstrong expression: see section 17 moderate expression: see section 09 10 11 12 13 14 15 16
diencephalon lateral wall mantle layer
strong strong
homogeneousstrong expression: see section 17 18 19 moderate expression: see section 07 08 09 10 11 12 13 14 15 16
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 19 20 21 22 23 24
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 12 13 14 23 24 moderate expression: see section 06 07 08 09 10 11 15 16 17 18 19 20 21 22
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 11 12 13 17 18 19 moderate expression: see section 16
medulla oblongata alar plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 13 14 15 16 17 18
medulla oblongata basal plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
metencephalon rest of alar plate mantle layer
strong strong
homogeneousstrong expression: see section 03 04 05 17 18 19 20 21 22 moderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
pons mantle layer
strong strong
homogeneousstrong expression: see section 04 05 17 18 19 moderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
midbrain mantle layer
strong strong
homogeneousstrong expression: see section 03 04 05 17 18 19 moderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 19 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 07 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22 23
vagus x ganglion
strong strong
regionalstrong expression: see section 08 09 17
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 07 08 17 18 19
spinal cord mantle layer
moderate moderate
homogeneousmoderate expression: see section 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 10 15 16
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 10 15 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 07 08 09 10 11 16 17
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 24
nasal cavity olfactory epithelium
moderate moderate
single cellmoderate expression: see section 13 weak expression: see section 16 17 18
nasal septum
weak weak
regionalweak expression: see section 12 13 14 15 16 17
vomeronasal organ
moderate moderate
single cellmoderate expression: see section 12 13 15 16
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
stomach
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 12 15 weak expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30147
Entity Detected:Wnt5b, wingless-related MMTV integration site 5B ( MGI:98959)
Sequence:sense strand is shown

>T30147
AGTGACTGCACCACACGGGCCTTCAGGCCGCTCCTCTCCGCCTTACAAAAGTCTATATTATATAAATCTA
TCTAAATATATTTTATATTTGTACAAATGGATGGATGGATGGATGATAGATAATCAAGAGAAGAAAGTGG
AGAGGAAGAGCTTAGGAGATGCTGGCCCTCTGTGAGGACTGGATTTTGCTGGAAATCCACAACCAGTGGG
AGAGAAACGGGCTTTTCCCCATTTTCTGGCCAGGACTTTTGGGACATGGGCTTGAGAGTGTCTGTGTGCC
ATAGCCTCCAGGAGTCAGGTGGGGATTAGATGAAGGAACTGGACTTATTCCACATCTACAGTCCTGTGGG
GAAGATGAGTGTCTGTGACCCTGGCCAGGAGACCCAGAGGCCCTGTGGAAAGACCTGATAACTGGGATGG
TAGCCTAGGTCTTCCTGAAAATGGAGCCAGCTTTGGGAAGGGGCTCTGTACTTCCTTCTTTTCTCATCTG
AGTACACACTGCAGGAAAGTCCCCTGCCCCAATATGGGGGAGTGGTCTCAAGTCACTCCAACCGGTGACC
GTAAGAGATCTGGGCCTCCCTGGACCCTGGCTCTGCCTTCTGATGAGAATGTCACTAGCTCCTGCCTCAA
GCTCTTGTGCCAAGAGAAAGACTGTTCCGTCACCTGCTACAGCCAGGAAGACGTGGAGCAAACCTGGGTT
TTGACTGGGGACCAAGTGCCTGTTGCACAGGACAGGAATCTGCTGTCACTCTGTCAAGGGAGGCTTTGAG
AATGACAGGGCATGCTAGCAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4211437), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 18192. Forward Primer - name:018192_F_IRAV28-31_O01_Wnt5b, sequence:AGTGACTGCACCACACGG; Reverse Primer - name:018192_R_SP6_IRAV28-31_O01_Wnt5b, sequence:ACCTGCTAGCATGCCCTG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12689 same embryo
 EMAGE:12688 same embryo
 EurExpress:euxassay_011466 same experiment
 MGI:4829225 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS