Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12696

Bub1b budding uninhibited by benzimidazoles 1 homolog, beta (S. cerevisiae) ( MGI:1333889)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12696 EMAGE:12696 EMAGE:12696 EMAGE:12696 EMAGE:12696
"Pseudo-wholemount" of euxassay_011420. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011420_01 euxassay_011420_02 euxassay_011420_03 euxassay_011420_04
EMAGE:12696 EMAGE:12696 EMAGE:12696 EMAGE:12696 EMAGE:12696
euxassay_011420_05 euxassay_011420_06 euxassay_011420_07 euxassay_011420_08 euxassay_011420_09
EMAGE:12696 EMAGE:12696 EMAGE:12696 EMAGE:12696 EMAGE:12696
euxassay_011420_10 euxassay_011420_11 euxassay_011420_12 euxassay_011420_13 euxassay_011420_14
EMAGE:12696 EMAGE:12696 EMAGE:12696 EMAGE:12696 EMAGE:12696
euxassay_011420_15 euxassay_011420_16 euxassay_011420_17 euxassay_011420_18 euxassay_011420_19
EMAGE:12696 EMAGE:12696 EMAGE:12696 EMAGE:12696 EMAGE:12696
euxassay_011420_20 euxassay_011420_21 euxassay_011420_22 euxassay_011420_23 euxassay_011420_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12696Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12696_wholemount_strong.wlz
12696_wholemount_moderate.wlz
12696_wholemount_weak.wlz
12696_wholemount_possible.wlz
12696_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12696_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
adrenal cortex
weak weak
regionalweak expression: see section 09 10 11 12 19 20 21
thymus primordium
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 09 10 11 19 20 21 moderate expression: see section 08 18
pancreas
moderate moderate
regionalmoderate expression: see section 11 12 13 14 17 18
thyroid gland
moderate moderate
regionalmoderate expression: see section 12 16
vibrissa
strong strong
regionalstrong expression: see section 24 moderate expression: see section 07 08 09 10 11 22 23 weak expression: see section 06
hypothalamus ventricular layer
strong strong
homogeneousstrong expression: see section 13 14 15
diencephalon lateral wall ventricular layer
strong strong
homogeneousstrong expression: see section 13 14 15
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 12 13 14 17 18 19
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 16 17 18 19
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 11 12 13 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 09 10
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 11 12 13 14 15 18 19 20 21 22 23 moderate expression: see section 09 10
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 14 15 16
ear
weak weak
regionalweak expression: see section 03 04 05 06 07 09 10 18 19 20 21 22 23 24
neural retina
moderate moderate
regionalmoderate expression: see section 01 weak expression: see section 02 03 04 05
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 16 17 18 19 20 21
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 14 16
esophagus
weak weak
regionalweak expression: see section 13 14
stomach
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11
hindgut
weak weak
regionalweak expression: see section 15 16
rectum
weak weak
regionalweak expression: see section 16 17
midgut
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 21
mandible
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 11 12 17 18 19 20 21 22 23 24
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 14 17 18 19
lower jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 20 21 weak expression: see section 22
maxilla
moderate moderate
regionalmoderate expression: see section 09 10 11 17 19 20 21
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 14 17 18 19
upper jaw molar
moderate moderate
regionalmoderate expression: see section 08 09 20 21 weak expression: see section 22
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
bladder
moderate moderate
regionalmoderate expression: see section 15 16 17 18 weak expression: see section 14
renal cortex
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 19 20 21 22 23
testis
weak weak
regionalweak expression: see section 07 08 09 10 22 23 24
lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
trachea
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 14
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 06 07 23 24 weak expression: see section 04 05 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T30293
Entity Detected:Bub1b, budding uninhibited by benzimidazoles 1 homolog, beta (S. cerevisiae) ( MGI:1333889)
Sequence:sense strand is shown

>T30293
GCCGAGCTGTTGACCAGTGCAAAGAAGAGGGAGGAGATGCAGAAGCAGATCGAAGAGATGGAGAGGAGGC
TGAAGGCAATGCAGGCTGTTCAGCAAGAAGGAGCTGGTGGCCAGCAAGAAGAGAAGATGCCTACAGAGGA
CCCAGCCAGATTGCAGATTGCTTCGGGGCCTCAGGAAATGTCGGGAGTTCCTCTGTCCTGTTCCATCTGT
CCACTAAGCTCGAATCCTAGGGAAATTTCACCTGCTGAGAACATTTTGCAAGAACAGCCTGATTCTAAAG
GTTCCAGTATGCCTTTCTCCATTTTTGATGAGTCTCTTTCAGACAAAAAAGACAAAAGTCCTGCTACAGG
TGGTCCACAGGTTCTCAATGCCCAGAGAAGACCCCTTTCAGTTCTCAAAACTACAGAAGTGGGCACCACA
AATGAGGATGTGTCTCCCGATATTTGTGATGAACTCACAGAACTTGAGCCTCTGAGTGAAGACGCCATCA
TCACTGGTTTCAGGAACGTCACTCTCTGTCCCAACCCTGAGGACACTTGTGACTTTGCTAGAGCAGCTCG
TTTGGCATCTACTCCTTTCCATGAGATACTGTCCTCGAAGGGCATCGCTGCTGATCCCGAGGGACTGTTG
CAGGAAGAGGATCTGGATGGGAAGGCCGCCGAGGCTCATCACACTGTTCATCACCAGGCCCTCATCATAA
AGAAACTGAGCCCAATTATTGAAGACAGCCGTGAGGCCACCCACTCATCTGGCTTCTCCAGGTCTTCTTC
CTCAGCTCCCAGTACATCCTCCATCAAAGGCTTTCAGCTTCTGGAAAAGCTGGAGCTGACTAATGACGGG
GCAGAAAATGCTATTCAGTCACCCTGGTGTTCACAGTATCGCCTACAACTGTTAAAATCCCTACTAGAGA
TAAGTGCTTTTGCGGAGTTTTCTGTGGAAGACCGACCGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4953223), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 28549. Forward Primer - name:028549_F_IRAV77-80_C02_Bub1b, sequence:GCCGAGCTGTTGACCAGT; Reverse Primer - name:028549_R_SP6_IRAV77-80_C02_Bub1b, sequence:ATCGGTCGGTCTTCCACA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12694 same embryo
 EMAGE:12693 same embryo
 EMAGE:12692 same embryo
 EMAGE:12695 same embryo
 EMAGE:12691 same embryo
 EurExpress:euxassay_011420 same experiment
 MGI:4823522 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS