Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12783

Uchl5 ubiquitin carboxyl-terminal esterase L5 ( MGI:1914848)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12783 EMAGE:12783 EMAGE:12783 EMAGE:12783 EMAGE:12783
"Pseudo-wholemount" of euxassay_011648. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011648_01 euxassay_011648_02 euxassay_011648_03 euxassay_011648_04
EMAGE:12783 EMAGE:12783 EMAGE:12783 EMAGE:12783 EMAGE:12783
euxassay_011648_05 euxassay_011648_06 euxassay_011648_07 euxassay_011648_08 euxassay_011648_09
EMAGE:12783 EMAGE:12783 EMAGE:12783 EMAGE:12783 EMAGE:12783
euxassay_011648_10 euxassay_011648_11 euxassay_011648_12 euxassay_011648_13 euxassay_011648_14
EMAGE:12783 EMAGE:12783 EMAGE:12783 EMAGE:12783 EMAGE:12783
euxassay_011648_15 euxassay_011648_16 euxassay_011648_17 euxassay_011648_18 euxassay_011648_19
EMAGE:12783 EMAGE:12783
euxassay_011648_20 euxassay_011648_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12783Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12783_wholemount_strong.wlz
12783_wholemount_moderate.wlz
12783_wholemount_weak.wlz
12783_wholemount_possible.wlz
12783_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12783_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 12 13 14 15 16
sublingual gland primordium
strong strong
regionalstrong expression: see section 10 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 07 08 09 17 18 19 20
pancreas
strong strong
regionalstrong expression: see section 13 16 moderate expression: see section 09 10 11 12
vibrissa
moderate moderate
regionalmoderate expression: see section 03 04 05 18 19 20
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 08 09 13 14
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 02 03 04 05 06 07 08 09 12 13 14 15 16 17 18 19 weak expression: see section 01 20 21
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 weak expression: see section 09 17
naris
weak weak
regionalweak expression: see section 09 10 11
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 16 17 weak expression: see section 06 07 08 09 10 11 13 15
vomeronasal organ
weak weak
regionalweak expression: see section 10 13
stomach
weak weak
regionalweak expression: see section 05 06 07 08 09 10
rectum
weak weak
regionalweak expression: see section 13
midgut
moderate moderate
regionalmoderate expression: see section 13 14 15 16 weak expression: see section 04 05 06 07 08 09 10 11 12
mandible
weak weak
regionalweak expression: see section 02 03 04 07 08 20 21
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15 weak expression: see section 09
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 10 11 14 15 weak expression: see section 09
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 18 19
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
bladder
weak weak
regionalExpression in the fundus region.
renal cortex
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 18 19 20 21
testis
weak weak
regionalweak expression: see section 06 07 08 09 20 21
urethra of male
weak weak
regionalweak expression: see section 13 14
lung
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17 18 19 20 21 weak expression: see section 05 06 07 08 09 10
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 20 weak expression: see section 03 04 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31636
Entity Detected:Uchl5, ubiquitin carboxyl-terminal esterase L5 ( MGI:1914848)
Sequence:sense strand is shown

>T31636
CCTGCTGGCTCTGTGGTTCAGGACTCCAGACTTGAAACAATATTTTTTGCCAAGCAGGTAATTAATAATG
CTTGTGCCACTCAGGCTATCGTAAGTGTACTACTGAACTGTACGCATCAAGATGTGCATTTAGGAGAGAC
ATTATCAGAATTTAAAGAATTTTCCCAAAGTTTTGATGCAGCTATGAAGGGGCTGGCATTGAGTAACTCA
GATGTGATTCGACAAGTGCACAACAGTTTTGCCAGGCAGCAGATGTTTGAATTTGATACAAAGACACCAG
CCAAAGAGGAGGATGCTTTTCACTTTGTCAGTTACGTTCCAGTCAATGGGAGGCTGTATGAACTAGATGG
GTTAAGAGAAGGCCCAATTGATTTAGGTGCATGCAATCAAGATGACTGGATTACTGCAGTGAGGCCAGTA
ATAGAGAAAAGGATTCAAAAGTATAGTGAAGGAGAAATTCGATTTAATTTAATGGCCATTGTATCTGACA
GAAAAATGATATATGAACAGAAGATAGCAGAGTTACAAAGACAACTTGCAGAGGAACCCATGGATACAGA
TCAAGGTAGTACCGTGTTAAGTGCTATTCAGTCAGAAGTTGCCAGAAACCAGATGCTTATTGAAGAAGAG
GTACAAAAGTTAAAGAGATATAAGATTGAAAATATCAGAAGGAAGCATAATTACTTGCCTTTCATTATGG
AGTTGTTAAAGACCTTAGCTGAGCACCAGCAGTTAATTCCACTTGTGGAAAAGGCAAAAGAAAAACAGAA
TGCAAAGAAAGCTCAGGAAACTAAGTGAAGAGGATATTTGGACGTGTGTACAGTGTGCTGCACTTAATTT
CATGGACACCATTAAATAAAAGGAACTTTGGACAACATCTTAATTGACTCAGTGCACGTTTGGCATAGTA
CCAGTCTGTCTTGTCCTTTATGCATGGAGTTAAAATTCTTTCCCTACCTGCATCATGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:2650799), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 11669. Forward Primer - name:011669_F_IRAV08-11_F07_Uchl5, sequence:CCTGCTGGCTCTGTGGTT; Reverse Primer - name:011669_R_SP6_IRAV08-11_F07_Uchl5, sequence:GCCCATGATGCAGGTAGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12784 same embryo
 EMAGE:12785 same embryo
 EurExpress:euxassay_011648 same experiment
 MGI:4829071 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS