Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12821

Idi1 isopentenyl-diphosphate delta isomerase ( MGI:2442264)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12821 EMAGE:12821 EMAGE:12821 EMAGE:12821 EMAGE:12821
"Pseudo-wholemount" of euxassay_011601. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011601_01 euxassay_011601_02 euxassay_011601_03 euxassay_011601_04
EMAGE:12821 EMAGE:12821 EMAGE:12821 EMAGE:12821 EMAGE:12821
euxassay_011601_05 euxassay_011601_06 euxassay_011601_07 euxassay_011601_08 euxassay_011601_09
EMAGE:12821 EMAGE:12821 EMAGE:12821 EMAGE:12821 EMAGE:12821
euxassay_011601_10 euxassay_011601_11 euxassay_011601_12 euxassay_011601_13 euxassay_011601_14
EMAGE:12821 EMAGE:12821 EMAGE:12821 EMAGE:12821 EMAGE:12821
euxassay_011601_15 euxassay_011601_16 euxassay_011601_17 euxassay_011601_18 euxassay_011601_19
EMAGE:12821 EMAGE:12821 EMAGE:12821 EMAGE:12821 EMAGE:12821
euxassay_011601_20 euxassay_011601_21 euxassay_011601_22 euxassay_011601_23 euxassay_011601_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12821Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12821_wholemount_strong.wlz
12821_wholemount_moderate.wlz
12821_wholemount_weak.wlz
12821_wholemount_possible.wlz
12821_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12821_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
adrenal gland
strong strong
regionalstrong expression: see section 08 09 10 17 18 19 weak expression: see section 11 20
thymus primordium
weak weak
regionalweak expression: see section 12 13 14 15 16
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 10 17 18 19 20
pancreas
weak weak
regionalweak expression: see section 10 11
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 08 09 21 22 23 weak expression: see section 05
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 15 16 17 moderate expression: see section 12
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 23 moderate expression: see section 12 13
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 15 16
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 weak expression: see section 08
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 18 19 weak expression: see section 02 03 04 05 06 07 16 17
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 weak expression: see section 05 06 16
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 07 08 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
ventral grey horn
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 10 11 17
cervical ganglion
moderate moderate
regionalmoderate expression: see section 09 17
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 13 14
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 09 10 11 12 13 17 18
neural retina
strong strong
regionalstrong expression: see section 01 02 03 23 24 moderate expression: see section 04 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 15 16 17 18 19
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 15 16
hindgut
moderate moderate
regionalmoderate expression: see section 14 15
rectum
moderate moderate
regionalmoderate expression: see section 14 15
midgut
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
mandible
moderate moderate
regionalmoderate expression: see section 02 03 04 22 23 24 weak expression: see section 05 06 07 08 09 10 19 20 21
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 13 16 17 weak expression: see section 12
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 20 21
maxilla
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 06 07 08 09 10 19 20 21
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 13 17 weak expression: see section 12
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 20 21
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 09 10 11 12 13 14 15 16 17 18 19 21 22 23 24 moderate expression: see section 08
renal cortex
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 17 18 19 20 21
testis
strong strong
regionalstrong expression: see section 06 07 21 22 moderate expression: see section 05 08 09 20
orbito-sphenoid
weak weak
regionalweak expression: see section 03 04 05 06 22 23 24
clavicle
weak weak
regionalweak expression: see section 11 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31648
Entity Detected:Idi1, isopentenyl-diphosphate delta isomerase ( MGI:2442264)
Sequence:sense strand is shown

>T31648
GTGTGAAGCGAGCAGCAAAGCGGCGCTTGAAAGCCGAGTTGGGAATACCCTTGGAAGAGGTTGATCTAAA
TGAAATGGATTATCTAACAAGAATTTACTACAAGGCCCAATCTGATGGTATCTGGGGTGAACATGAAGTT
GATTACATTCTGTTTCTGAGGAAGAATGTAACCTTGAATCCAGATCCCAACGAGATTAAAAGCTATTGCT
ATGTATCAAAGGAAGAAGTCAGAGAAATTTTGAAGAAGGCAGCCAGTGGTGAAATTAAGTTAACTCCGTG
GTTTAAGATAATTGCAGATACTTTCCTCTTCAAATGGTGGGATAACTTAAACCATTTGAGTCCATTTGTT
GACCATGAGAAAATACATAGATTGTGAATGTGTAAATGATTTGAAAAATTTTCTACCTGGTAAGAATGGT
TTGGTTTGGTTTTAAATTGGGCCCTCTTATATGATACATAGGTATTTTACAACCAGAATTTGTTTTGAGA
AAAGAAAAACTCAACTAGCTTACAGTTTTATATCATATATCCCATATATATGCACTGATGTCTGTAAAAG
ATATTTAGGTGAGGTTATTGCAAAATTATGCCATAAGTAAAACTTAATTTAGCCTGTCCAAATACCTGGC
TATGACAAGATTGAGGAAGTAACTAGAACTCATATTTTACATTTGATAGACACTTTCAGAACTCTTTGCT
AATTGTCAAGTGTTGTTTATATCTTTAGATTTTTATCATACATCAGAAAATTGAGCAGCTGCTTTGAAAC
AGCACTAAGAGGTTAAATGGGCAGGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3589498), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 38277. Forward Primer - name:038277_F_IRAV08-11_I21_Idi1, sequence:GTGTGAAGCGAGCAGCAA; Reverse Primer - name:038277_R_SP6_IRAV08-11_I21_Idi1, sequence:GCCCTGCCCATTTAACCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12824 same embryo
 EMAGE:12823 same embryo
 EMAGE:12822 same embryo
 EMAGE:12820 same embryo
 EurExpress:euxassay_011601 same experiment
 MGI:4825502 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS