Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12830

Psen1 presenilin 1 ( MGI:1202717)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12830 EMAGE:12830 EMAGE:12830 EMAGE:12830 EMAGE:12830
"Pseudo-wholemount" of euxassay_011643. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011643_01 euxassay_011643_02 euxassay_011643_03 euxassay_011643_04
EMAGE:12830 EMAGE:12830 EMAGE:12830 EMAGE:12830 EMAGE:12830
euxassay_011643_05 euxassay_011643_06 euxassay_011643_07 euxassay_011643_08 euxassay_011643_09
EMAGE:12830 EMAGE:12830 EMAGE:12830 EMAGE:12830 EMAGE:12830
euxassay_011643_10 euxassay_011643_11 euxassay_011643_12 euxassay_011643_13 euxassay_011643_14
EMAGE:12830 EMAGE:12830 EMAGE:12830 EMAGE:12830 EMAGE:12830
euxassay_011643_15 euxassay_011643_16 euxassay_011643_17 euxassay_011643_18 euxassay_011643_19
EMAGE:12830 EMAGE:12830 EMAGE:12830 EMAGE:12830 EMAGE:12830
euxassay_011643_20 euxassay_011643_21 euxassay_011643_22 euxassay_011643_23 euxassay_011643_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12830Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12830_wholemount_strong.wlz
12830_wholemount_moderate.wlz
12830_wholemount_weak.wlz
12830_wholemount_possible.wlz
12830_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12830_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 07 08 09 10 17 18 19 20 21
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 16 17 18
pons mantle layer
weak weak
regionalweak expression: see section 07 18
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 06 21 22 23
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 19 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 17 18 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 09 18
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 08 18 19 20
trigeminal v nerve
weak weak
regionalweak expression: see section 10 17 18
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 13 14 15 16 18 19 20 21
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 04 05 23 24
neural retina
weak weak
regionalweak expression: see section 01 02 03 04 23 24
hindgut
weak weak
regionalweak expression: see section 16 17
rectum
weak weak
regionalweak expression: see section 17
midgut
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
bladder
weak weak
regionalweak expression: see section 15 16
urethra of male
weak weak
regionalweak expression: see section 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31703
Entity Detected:Psen1, presenilin 1 ( MGI:1202717)
Sequence:sense strand is shown

>T31703
GCATGGCTCATCTTGGCTGTGATTTCAGTATATGATTTGGTGGCTGTTTTATGTCCCAAAGGCCCACTTC
GTATGCTGGTTGAAACAGCTCAGGAAAGAAATGAGACTCTCTTTCCAGCTCTTATCTATTCCTCAACAAT
GGTGTGGTTGGTGAATATGGCTGAAGGAGACCCAGAAGCCCAAAGGAGGGTACCCAAGAACCCCAAGTAT
AACACACAAAGAGCGGAGAGAGAGACACAGGACAGTGGTTCTGGGAACGATGATGGTGGCTTCAGTGAGG
AGTGGGAGGCCCAAAGAGACAGTCACCTGGGGCCTCATCGCTCCACTCCCGAGTCAAGAGCTGCTGTCCA
GGAACTTTCTGGGAGCATTCTAACGAGTGAAGACCCGGAGGAAAGAGGAGTAAAACTTGGACTGGGAGAT
TTCATTTTCTACAGTGTTCTGGTTGGTAAGGCCTCAGCAACCGCCAGTGGAGACTGGAACACAACCATAG
CCTGCTTTGTAGCCATACTGATCGGCCTGTGCCTTACATTACTCCTGCTCGCCATTTTCAAGAAAGCGTT
GCCAGCCCTCCCCATCTCCATCACCTTCGGGCTCGTGTTCTACTTCGCCACGGATTACCTTGTGCAGCCC
TTCATGGACCAACTTGCATTCCATCAGTTTTATATCTAGCCTTTCTGCAGTTAGAACATGGATGTTTCTT
CTTTGATTATCAAAAACACAAAAACAGAGAGCAAGCCCGAGGAGGAGACTGGTGACTTTCCTGTGTCCTC
AGCTAACAAAGGCAGGACTCCAGCTGGACTTCTGCAGCTTCCTTCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:5133302), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 38012. Forward Primer - name:038012_F_IRAV81-84_O11_Psen1, sequence:GCATGGCTCATCTTGGCT; Reverse Primer - name:038012_R_SP6_IRAV81-84_O11_Psen1, sequence:CGGAAGGAAGCTGCAGAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12829 same embryo
 EMAGE:12828 same embryo
 EurExpress:euxassay_011643 same experiment
 MGI:4827467 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS