Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12860

Pcbp3 poly(rC) binding protein 3 ( MGI:1890470)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12860 EMAGE:12860 EMAGE:12860 EMAGE:12860 EMAGE:12860
"Pseudo-wholemount" of euxassay_013701. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013701_01 euxassay_013701_02 euxassay_013701_03 euxassay_013701_04
EMAGE:12860 EMAGE:12860 EMAGE:12860 EMAGE:12860 EMAGE:12860
euxassay_013701_05 euxassay_013701_06 euxassay_013701_07 euxassay_013701_08 euxassay_013701_09
EMAGE:12860 EMAGE:12860 EMAGE:12860 EMAGE:12860 EMAGE:12860
euxassay_013701_10 euxassay_013701_11 euxassay_013701_12 euxassay_013701_13 euxassay_013701_14
EMAGE:12860 EMAGE:12860 EMAGE:12860 EMAGE:12860 EMAGE:12860
euxassay_013701_15 euxassay_013701_16 euxassay_013701_17 euxassay_013701_18 euxassay_013701_19
EMAGE:12860 EMAGE:12860 EMAGE:12860 EMAGE:12860 EMAGE:12860
euxassay_013701_20 euxassay_013701_21 euxassay_013701_22 euxassay_013701_23 euxassay_013701_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12860Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12860_wholemount_strong.wlz
12860_wholemount_moderate.wlz
12860_wholemount_weak.wlz
12860_wholemount_possible.wlz
12860_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12860_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
pineal primordium
strong strong
regionalstrong expression: see section 13 14
olfactory cortex
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 16 17 18 19 moderate expression: see section 07 08 20 21 22
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 09 10 11 12
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 07 08 14 15 16
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 05 06
pons mantle layer
strong strong
regionalstrong expression: see section 05 06 15 16 17
pons marginal layer
strong strong
regionalstrong expression: see section 07
midbrain mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16
facial vii ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 19 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 17 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 06 07 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 16 17 18 19
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 10 16 17 18
ventral grey horn
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 14 15
cervical ganglion
strong strong
regionalstrong expression: see section 07 08 15 16
thoracic ganglion
strong strong
regionalstrong expression: see section 10 11 12 13 14
dorsal root ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 15 16 17
neural retina
strong strong
regionalstrong expression: see section 01 02 03 04 24
heart ventricle
moderate moderate
spottedmoderate expression: see section 07 08 09 10 11 12 14 15
tongue
strong strong
spottedstrong expression: see section 12 15 16
stomach
strong strong
spottedstrong expression: see section 09 10 11 moderate expression: see section 01 02 03 04 05 06 07 08
midgut
strong strong
spottedstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20 moderate expression: see section 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31709
Entity Detected:Pcbp3, poly(rC) binding protein 3 ( MGI:1890470)
Sequence:sense strand is shown

>T31709
GTCGTCAGAGCGCCAGATTACCATCACAGGGACCCCAGCCAACATCAGCCTTGCCCAGTATCTCATCAAC
GCTAGGCTGACGTCTGAGGTCACCGGGATGGGTGCACTCTAACCTACCCAAGGTCCTCCACTGCACACAT
CGGATGGCTCCAGCCCGCAGCCTCACCAGCTGGCACACTGTACAGACTGCCTGTCCTTCCTTGCAGATAT
GAATAGAGCGTTTTCTTTACAAACAGATGATAGTGCGTGTCTGCCCACTCAGGCCCTGTGCGCTCCGTGT
TAGTGTAGCCCTCCACGCATTGGCATGCAGCTCTTTACTTTACTGCTCAACGTATTCCCAAATGTGATGT
TTCAGAGATTTATTCCTCAGTATCCATGTGACTGTCTGTTTAAAAGTTGGTTTGATGCTTTAACAGCACT
TCCTATGTCCTGCTGTCCCTTGTTCTCAGAGACCCTCCTCTCTCACCCAGTCTACTGACTCATTTCCGCC
CTAGGTTGTATGCAGGGATCAGAGGTACTTTTATTGCAACCTGCAGGGAGTGTCTGGAAGAGGAGGGACT
TGGGGGTGTATCTAAGGAGCAGGGTAGAGTGCCAGAGGGTGGGGTGGGACCCTGACTTCACTGGGATATC
TCGGGGAGGGGGCACTTGTGCCCTCCAGGTGTCTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4511401), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 57760. Forward Primer - name:057760_F_IRAV87_d12_Pcbp3, sequence:GTCGTCAGAGCGCCAGAT; Reverse Primer - name:057760_R_SP6_IRAV87_d12_Pcbp3, sequence:GAAGACACCTGGAGGGCA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12863 same embryo
 EMAGE:12861 same embryo
 EMAGE:12862 same embryo
 EurExpress:euxassay_013701 same experiment
 MGI:4827074 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS