Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12868

Trrap transformation/transcription domain-associated protein ( MGI:2153272)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12868 EMAGE:12868 EMAGE:12868 EMAGE:12868 EMAGE:12868
"Pseudo-wholemount" of euxassay_013672. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013672_01 euxassay_013672_02 euxassay_013672_03 euxassay_013672_04
EMAGE:12868 EMAGE:12868 EMAGE:12868 EMAGE:12868 EMAGE:12868
euxassay_013672_05 euxassay_013672_06 euxassay_013672_07 euxassay_013672_08 euxassay_013672_09
EMAGE:12868 EMAGE:12868 EMAGE:12868 EMAGE:12868 EMAGE:12868
euxassay_013672_10 euxassay_013672_11 euxassay_013672_12 euxassay_013672_13 euxassay_013672_14
EMAGE:12868 EMAGE:12868 EMAGE:12868 EMAGE:12868 EMAGE:12868
euxassay_013672_15 euxassay_013672_16 euxassay_013672_17 euxassay_013672_18 euxassay_013672_19
EMAGE:12868 EMAGE:12868 EMAGE:12868 EMAGE:12868
euxassay_013672_20 euxassay_013672_21 euxassay_013672_22 euxassay_013672_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12868Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12868_wholemount_strong.wlz
12868_wholemount_moderate.wlz
12868_wholemount_weak.wlz
12868_wholemount_possible.wlz
12868_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12868_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 08 09 10 11 18 19 20 21 22
vibrissa
weak weak
regionalweak expression: see section 07 08 09 10 20 21 22 23
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 21 22
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 09 19 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 18 19 20 21 22
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 08
dorsal root ganglion
weak weak
regionalweak expression: see section 08 09 10 11 12 16 17 18
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17 18
lower jaw molar
weak weak
regionalweak expression: see section 08 09 19 20
upper jaw incisor
weak weak
regionalweak expression: see section 12 13 16 17
upper jaw molar
weak weak
regionalweak expression: see section 08 09 19 20
testis
strong strong
regionalstrong expression: see section 06 07 20 21 22 moderate expression: see section 05 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31635
Entity Detected:Trrap, transformation/transcription domain-associated protein ( MGI:2153272)
Sequence:sense strand is shown

>T31635
TCTCTGCCTTGTTCCCCACTTTATTCAGTTACCTTCCCAGTAGTTTGTGTGTGGAAGAGCATGAGATTAG
TCCTGGAGGGAGCCCCTGCACACAGTAGGCCAGGCCGTTGGCGATGGCAGAGCTGAACTCAGCAGCTTCC
GAGATGCCTTTTAACTTGAGGAGCCCTGAACTGGGACTCCCTGTGTACTCCTGTCTCAGTGTGAAGTGCA
GACTGAGAACGTCCCCTCCATCCCCCAACTTCCAGAAACTACACCTCAGAGTGGCTGCTCACTGTCATAC
CGGGTCTAGGGAATCCACAGTGTTAGAGAAGCAGGAAGCAGGATCAGTTCGACAGGCGTGCATCTCTGAG
CACAGATCTCACTCTGTCACTGGTGTGGACATCTCGCCAAGTCTGATGATGAGGCTCAGCGAGCCCAGGG
CCTGCAGGGGAAGCTGCTCCAGGCCTCATCAGTCAGATCCGATGCAGCTGTGCAGAACGAAGCTGTGAGG
CCAGCGGGCCAGCCTTTCTCTTTTTACTGCCGGCTTGTTGGATATCTTTTAGAGATTTACTATCATTGTA
CCAGAAAGAAGAAAAAAAAAAGACAAAATCATTTTGTTTTTCCTTCCTAATTTAAAAAGAAAGCAGTGAA
AGTTTGTCCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:2655777), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 38398. Forward Primer - name:038398_F_IRAV08-11_F01_AI481500, sequence:TCTCTGCCTTGTTCCCCA; Reverse Primer - name:038398_R_SP6_IRAV08-11_F01_AI481500, sequence:GGGGACAAACTTTCACTGCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12867 same embryo
 EMAGE:12866 same embryo
 EMAGE:12864 same embryo
 EMAGE:12865 same embryo
 EurExpress:euxassay_013672 same experiment
 MGI:4828945 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS