Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12870

Psma1 proteasome (prosome, macropain) subunit, alpha type 1 ( MGI:1347005)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12870 EMAGE:12870 EMAGE:12870 EMAGE:12870 EMAGE:12870
"Pseudo-wholemount" of euxassay_013664. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013664_01 euxassay_013664_02 euxassay_013664_03 euxassay_013664_04
EMAGE:12870 EMAGE:12870 EMAGE:12870 EMAGE:12870 EMAGE:12870
euxassay_013664_05 euxassay_013664_06 euxassay_013664_07 euxassay_013664_08 euxassay_013664_09
EMAGE:12870 EMAGE:12870 EMAGE:12870 EMAGE:12870 EMAGE:12870
euxassay_013664_10 euxassay_013664_11 euxassay_013664_12 euxassay_013664_13 euxassay_013664_14
EMAGE:12870 EMAGE:12870 EMAGE:12870 EMAGE:12870 EMAGE:12870
euxassay_013664_15 euxassay_013664_16 euxassay_013664_17 euxassay_013664_18 euxassay_013664_19
EMAGE:12870 EMAGE:12870 EMAGE:12870 EMAGE:12870
euxassay_013664_20 euxassay_013664_21 euxassay_013664_22 euxassay_013664_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12870Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12870_wholemount_strong.wlz
12870_wholemount_moderate.wlz
12870_wholemount_weak.wlz
12870_wholemount_possible.wlz
12870_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12870_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 10 11 12 16 17 18 19 20 21 22 23
thymus primordium
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 17 18 19 20
pancreas
weak weak
regionalweak expression: see section 10 11 12 13
thyroid gland
weak weak
regionalweak expression: see section 11 15
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 07 08 19 20 21 22
olfactory cortex ventricular layer
weak weak
homogeneousweak expression: see section 10 11 15 16
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 14 15 16 17 18 19 20 21 22
midbrain ventricular layer
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 07 18 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 08 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 16 17 18 19 weak expression: see section 08
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 03 22 23
neural retina
weak weak
regionalweak expression: see section 01 02 23
naris
weak weak
regionalweak expression: see section 11 12 13 14 15 16
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 08 09 10 11 12 14 15 16 17 18 19
vomeronasal organ
weak weak
regionalweak expression: see section 12 14
midgut
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16 17
mandible
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 04 05
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 15 16
lower jaw molar
weak weak
regionalweak expression: see section 06 07 08 18 19
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 15 16
upper jaw molar
weak weak
regionalweak expression: see section 06 08 19
liver lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
metanephros
moderate moderate
regionalmoderate expression: see section 08 09 10 11 18 19 20 21 22
testis
weak weak
regionalweak expression: see section 06 07 08 09 21 22
lung
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 22 weak expression: see section 03 04 05 16 17 18 19 20 21 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 03 04 05 21 22
clavicle
moderate moderate
regionalmoderate expression: see section 10 weak expression: see section 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31639
Entity Detected:Psma1, proteasome (prosome, macropain) subunit, alpha type 1 ( MGI:1347005)
Sequence:sense strand is shown

>T31639
GTTCCTGTGTCCGCTGCTGGGTCAGGTTGTCGCTGCGCCGGAGCTATGTTTCGAAACCAGTATGACAATG
ATGTCACTGTTTGGAGCCCTCAGGGCAGGATTCATCAAATTGAATATGCAATGGAAGCTGTTAAGCAAGG
TTCAGCAACAGTTGGTCTAAAATCAAAAACGCACGCAGTGCTGGTTGCACTGAAGAGAGCACAGTCAGAG
CTTGCCGCTCACCAGAAGAAAATTCTCCATGTTGACAACCATATTGGTATCTCAATTGCGGGTCTAACTG
CTGATGCCAGACTGTTATGCAACTTTATGCGCCAGGAGTGTTTGGATTCCAGATTTGTGTTTGACAGACC
ACTTCCTGTGTCTCGTCTTGTGTCTCTAATTGGAAGCAAAACCCAGATCCCAACACAGCGATATGGCCGG
AGGCCGTATGGTGTTGGGCTGCTCATTGCTGGTTATGATGATATGGGCCCTCATATTTTCCAAACCTGTC
CATCTGCTAACTATTTTGACTGCAGAGCTATGTCTATTGGAGCCCGTTCTCAATCAGCTCGTACTTACCT
GGAGAGACATATGTCTGAATTTATGGAGTGCAATTTGGATGAACTGGTTAAACATGGTCTGCGTGCCTTA
AGAGAAACACTCCCTGCAGAGCAGGACCTGACCACAAAGAATGTTTCCATTGGAATCGTTGGTAAAGACT
TGGAATTTACAATCTACGATGATGATGATGTATCTCCATTCCTGGATGGTCTTGAAGAAAGACCACAGAG
AAAAGCACAGCCTTCACAGGCTGCTGAGGAACCTGCAGAAAAAGCCGATGAACCAATGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:2655483), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 12414. Forward Primer - name:012414_F_IRAV08-11_F19_Psma1, sequence:GTTCCTGTGTCCGCTGCT; Reverse Primer - name:012414_R_SP6_IRAV08-11_F19_Psma1, sequence:TCCATTGGTTCATCGGCT. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12869 same embryo
 EurExpress:euxassay_013664 same experiment
 MGI:4827470 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS